DNASU Plasmid Repository • 480.965.5697 | Email

CFTR (Homo sapiens) in pSGX-TOPO (His-tagged baculovirus expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CFTR
Gene Name:  cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Sequence             
Original Clone ID: 5762c38KFg2h2
Keyword: Partial Protein, NBD1 linked to NBD2 domain
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX-TOPO               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 linked to NBD2 domain with other intended mutations and corresponds to region 388-1445 on full length protein NP_000483.3.
Comments: N-terminal 6-His, cleavable, TOPO. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
Yes / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
HsCD00287205

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1503nts         Open reading frame : 1 to 1503
Reference Sequence Alignment

ACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGAGGTACTCCT
GTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCC
ACTGGAGCAGGCAAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAG
GGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCT
GGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGC
GTCATCAAAGCATGCCAACTAGAAGAAGACATCTCCAAGTTTGCAGAGAAAGACAATATA
GTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCA
AGAGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGAT
GTTTTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACT
AGGATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTG
CATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGAC
TTTAGCTCAAAACTCATGGGAGGTGGTGGTGGTAGCGGCGGCGGCGGCTCTGGAGGAGGA
GGAAGTGGGGGGGGGGGGTCCATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCC
TCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCC
ATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGA
ACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGA
GAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGGAACAGTGGAGGAAAGCC
TTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGAT
CCCTATGAACAGTGGAGTGACCAAGAAATATGGAAAGTTGCAGATGAGGTTGGGCTCAGA
TCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTC
CTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAG
ATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACATACCAAATAATTAGA
AGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAAGCCAGGATAGAA
GCAATGCTGGAATGCGATCAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGAT
TCCATCCAGAAACTGCTGAACGAGAGGAGCGACTTCCGGCAAGCCATCAGCCCCTCCGAC
TAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
End on protein reference sequence 1445
Start on protein reference sequence 388
Mutations:


del@647,545

Discrepancy:
None
Others:
Domain NBD1 linked to NBD2
Termini 388-1445
5' Linker Sequence:
CGACCGAAAACCTGTATTTTCAGGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  insect cells    Marker:  gentamicin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 5762c
Recommended expression in: SF9
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX-TOPO

pSGX-TOPO in advanced viewed

Synonyms: pSGX-TOPO_KF
Sequencing Primer: Forward:  pFB forward
Reverse:  pFB reverse
Description: Baculovirus vector, adds N-terminal 6xHis tag and TEV protease site; ampicillin resistance in bacteria (gentamicin resistance in insect cells); TOPO cloning.
Comments: pFastBAC topogated N-His with TEV.
Size (bp): 4793
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, baculovirus/insect cell expression, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation ATG 4050 4052
TOPO recognition site TOPO TOPO cloning site 4123 4132
bacterial origin ori pUC-type origin of replication 1544 2226
poly-A signal polyA SV40 poly-A signal sequence 4222 4413
primer pFB reverse reverse sequencing primer: ACAAATGTGGTATGGCTGATT 4183 4203
primer pFB foward forward sequencing primer: TATTCCGGATTATTCATACC 3995 4014
promoter PH polyhedrin promoter 3904 4032
promoter Pc Pc promoter 0 0
selectable marker AmpR ampicillin resistance gene 787 1446
selectable marker GenR gentamycin resistance gene 3000 3533
ssDNA origin f1 ori f1 origin 19 325
tag His 6xHis tag 4062 4079
transposon fragment Tn7R Tn7R transposon sequence 2709 2933
transposon fragment Tn7L Tn7L transposon sequence 0 0

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CFTR
Symbol Nomenclature : CFTR
SYNONYM : ABC35; ABCC7; CF; CFTR/MRP; MRP7; TNR-CFTR; dJ760C5.1
Designation : cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator
Full Nomenclature : cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
GENEID : 1080
Locus Tag : tcag7.78
GenBank Accession : NP_000483.3
HGNC : 1884
MIM : 602421
Vega : OTTHUMG00000023076
Target GenBank: NP_000483.3

 

Reference Sequence Alignment

  

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCGCG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATAT
                                                                              

HsCD00287205      ---------------------ACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
NM_000492.3       AAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
                                       ***************************************

HsCD00287205      TGGGAGGAGG--------------------------------------------------
NM_000492.3       TGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAA
                  **********                                                  

HsCD00287205      ----------------------------------------------GAGGTACTCCTGTC
NM_000492.3       ACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTC
                                                                 :************

HsCD00287205      CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
NM_000492.3       CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
                  ************************************************************

HsCD00287205      GGAGCAGGCAAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGT
NM_000492.3       GGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGT
                  ***************************.********************************

HsCD00287205      AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
NM_000492.3       AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
                  ************************************************************

HsCD00287205      ACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTC
NM_000492.3       ACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTC
                  ************************************************************

HsCD00287205      ATCAAAGCATGCCAACTAGAAGAAGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
NM_000492.3       ATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
                  ***********************.************************************

HsCD00287205      CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
NM_000492.3       CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
                  ************************************************************

HsCD00287205      GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
NM_000492.3       GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
                  ************************************************************

HsCD00287205      TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
NM_000492.3       TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
                  ************************************************************

HsCD00287205      ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
NM_000492.3       ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
                  ************************************************************

HsCD00287205      GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
NM_000492.3       GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
                  ************************************************************

HsCD00287205      AGCTCAAAACTCATGGGAGGTGGTGGTGGTAGCGGCGGCGGCGGCTCTGGAG--------
NM_000492.3       AGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCA
                  ****************** ***.*  *   ..* ..   .* * . .:.**.        

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATT
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       CCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTC
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       GCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTA
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       ACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTG
                                                                              

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAA
                                                                              

HsCD00287205      ----------GAGGAGGAAGTGGGGGGGGGGGGTCCATTGAGAATTCACACGTGAAGAAA
NM_000492.3       CCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAA
                            .:**. .*.    *...*  . *:  ************************

HsCD00287205      GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
NM_000492.3       GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
                  ************************************************************

HsCD00287205      GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
NM_000492.3       GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
                  ************************************************************

HsCD00287205      GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
NM_000492.3       GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
                  ************************************************************

HsCD00287205      CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGGAA
NM_000492.3       CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAA
                  ********************************************************* **

HsCD00287205      CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
NM_000492.3       CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
                  ************************************************************

HsCD00287205      AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGACCAAGAAATATGGAAAGTTGCAGAT
NM_000492.3       AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGAT
                  *********************************** ************************

HsCD00287205      GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
NM_000492.3       GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
                  ************************************************************

HsCD00287205      GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
NM_000492.3       GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
                  ************************************************************

HsCD00287205      CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
NM_000492.3       CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
                  ************************************************************

HsCD00287205      TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
NM_000492.3       TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
                  ************************************************************

HsCD00287205      GAAGCCAGGATAGAAGCAATGCTGGAATGCGATCAATTTTTGGTCATAGAAGAGAACAAA
NM_000492.3       GAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAA
                  *** .************************* *:***************************

HsCD00287205      GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCGACTTCCGGCAAGCC
NM_000492.3       GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC
                  ********************************************* :*************

HsCD00287205      ATCAGCCCCTCCGACTAA------------------------------------------
NM_000492.3       ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCT
                  ***************:..                                          

HsCD00287205      ------------------------------------------------------------
NM_000492.3       AAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTT
                                                                              

HsCD00287205      ---
NM_000492.3       TAG
                     

Pathways

Reactome : ABC-family proteins mediated transport
Reactome : Transmembrane transport of small molecules

Protein

Domain : NBD1 linked to NBD2
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : P13569
HPRD : 03883

Clone

Cloning Information : 473955
HIP Master Clone ID : 395461
Original Clone ID : 5762c38KFg2h2

Experimental

TargetTrack - Experimental data : 5762c

Organism


TAX_ID : 9606
Species Specific ID: 1080

Genome

Chromosome : 7
Map Location : 7q31.2
Ensembl : ENSG00000001626

Reagents

Labome : CFTR-antibody