DNASU Plasmid Repository • 480.965.5697 | Email

CFTR (Homo sapiens) in pSGX4 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CFTR
Gene Name:  cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Sequence             
Original Clone ID: 5832c619BSt1pi1
Keyword: Partial Protein, NBD2 domain
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX4               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD2 domain with other intended mutations and corresponds to region 1193-1444 on full length protein NP_000483.3.
Comments: N-terminal 6-His and Smt3, cleavable, TOPO. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
Yes / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
HsCD00287402

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/Smt3/SUMO

 

Insert sequence: 762nts        
Open reading frame : 1 to 762
Reference Sequence Alignment

ATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTC
AAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTC
TCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACT
TTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTG
TCTTGGGATTCAATAACTTTGGAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAA
GTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGAC
CAAGAAATATGGAAAGTTGCAGATGAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCT
GGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAG
TTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCC
AGTGCTCATTTGGATCCAGTAACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTT
GCTGATTGCACAGTAATTCTCTGTGAAGCCAGGATAGAAGCAATGCTGGAATGCGATCAA
TTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAAC
GAGAGGAGCGACTTCCGGCAAGCCATCAGCCCCTCCTGATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
Start on protein reference sequence 1193
End on protein reference sequence 1444
Mutations:
Q1280E, H1402A, Q1411D, L1436D

Q1280E; H1402A; Q1411D; L1436D

Discrepancy:
None
Others:
Termini 1193-1444
Domain NBD2
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 5832c
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX4

pSGX4 in advanced viewed

Synonyms: pSGX-4, pSGX4_BS
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites.
Size (bp): 5611
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5435 5444
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site (recognizes the tertiary structure of SUMO) 5140 5140
repressor protein gene LacI lacI cds 3515 4351
ribosome binding site RBS ribosome binding site (RBS) 5062 5068
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 Smt3 tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5539 5585

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CFTR
Symbol Nomenclature : CFTR
SYNONYM : ABC35; ABCC7; CF; CFTR/MRP; MRP7; TNR-CFTR; dJ760C5.1
Designation : cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator
Full Nomenclature : cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
GENEID : 1080
Locus Tag : tcag7.78
GenBank Accession : NP_000483.3
HGNC : 1884
MIM : 602421
Vega : OTTHUMG00000023076
Target GenBank: NP_000483.3

 

Reference Sequence Alignment

  

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCGCG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATAT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATT
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       CCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTC
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       GCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTA
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       ACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTG
                                                                              

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAA
                                                                              

HsCD00287402      ------------------------------------ATTGAGAATTCACACGTGAAGAAA
NM_000492.3       CCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAA
                                                      ************************

HsCD00287402      GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
NM_000492.3       GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
                  ************************************************************

HsCD00287402      GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
NM_000492.3       GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
                  ************************************************************

HsCD00287402      GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
NM_000492.3       GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
                  ************************************************************

HsCD00287402      CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGGAA
NM_000492.3       CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAA
                  ********************************************************* **

HsCD00287402      CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
NM_000492.3       CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
                  ************************************************************

HsCD00287402      AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGACCAAGAAATATGGAAAGTTGCAGAT
NM_000492.3       AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGAT
                  *********************************** ************************

HsCD00287402      GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
NM_000492.3       GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
                  ************************************************************

HsCD00287402      GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
NM_000492.3       GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
                  ************************************************************

HsCD00287402      CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
NM_000492.3       CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
                  ************************************************************

HsCD00287402      TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
NM_000492.3       TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
                  ************************************************************

HsCD00287402      GAAGCCAGGATAGAAGCAATGCTGGAATGCGATCAATTTTTGGTCATAGAAGAGAACAAA
NM_000492.3       GAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAA
                  *** .************************* *:***************************

HsCD00287402      GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCGACTTCCGGCAAGCC
NM_000492.3       GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC
                  ********************************************* :*************

HsCD00287402      ATCAGCCCCTCCTGATAA------------------------------------------
NM_000492.3       ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCT
                  ************ ..:..                                          

HsCD00287402      ------------------------------------------------------------
NM_000492.3       AAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTT
                                                                              

HsCD00287402      ---
NM_000492.3       TAG
                     

Pathways

Reactome : ABC-family proteins mediated transport
Reactome : Transmembrane transport of small molecules

Protein

Domain : NBD2
Structural Annotation Wiki : TOPSAN
UniProt : P13569
HPRD : 03883

Clone

Cloning Information : 474153
HIP Master Clone ID : 395659
Original Clone ID : 5832c619BSt1pi1

Experimental

TargetTrack - Experimental data : 5832c

Organism


TAX_ID : 9606
Species Specific ID: 1080

Genome

Chromosome : 7
Map Location : 7q31.2
Ensembl : ENSG00000001626

Reagents

Labome : CFTR-antibody