DNASU Plasmid Repository • 480.965.5697 | Email

Cftr (Mus musculus) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Cftr
Gene Name:  cystic fibrosis transmembrane conductance regulator
Sequence             
Original Clone ID: 5784f2BCt2p1
Keyword: Partial Protein, NBD1 domain
Species: Mus musculus
Type: cDNA
Vector Name: pSGX3               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 domain with other intended mutations and corresponds to region 388-673 on full length protein NP_066388.1.
Comments: C-terminal 6-His, TOPO. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
Yes / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
MmCD00287510

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 908nts         Open reading frame : 1 to 908

ATGACCACAGGCATAATCATGGAAAATGTAACAGCATTTTGGGAGGAGGGATTTGGGGAA
TTACTGGAGAAAGTACAACAAAGCAATGGTGACAGAAAACATTCCAGTGATGAGAACAAT
GTCAGTTTCAGTCATCTCTGCCTTGTGGGAAATCCTGTGCTGAAAAACATCAATTTGAAT
ATAGAGAAAGGAGAGATGTTGGCTATTACTGGATCTACTGGATCAGGAAAGACATCACTC
CTGATGTTGATTTTGGGAGAACTGGAAGCTTCAGAGGGAATTATTAAGCACAGTGGAAGA
GTTTCATTCTGCTCTCAATTTTCTTGGATTATGCCGGGTACTATCAAAGAAAATATCATC
GGTGTTTCCTATGATGAGTACAGATATAAGAGTGTTGTCAAAGCTTGCCAACTACAGCAG
GACATCACCAAGTTTGCAGAACAAGACAACACAGTTCTTGGAGAAGGTGGAGTCACACTG
AGTGGAGGTCAGCGTGCAAGGATTTCTTTAGCAAGAGCAGTATATAAAGATGCTGATTTG
TACCTATTAGATTCCCCTTTTGGGTATCTAGATGTTTTTACTGGAGAACAAGTATTTGAA
AGCTGTGTTTGTAAATTGATGGCCAACAAAACTAGGATTTTGGTTACATCTAAAATGGAA
CACTTAAGGAAAGCTGACAAAATACTAATTTTGCATCAGGGCAGTAGCTATTTTTATGGG
ACATTTTCTGAGCTACAAAGTCTACGTCCAGACTTCAGTTCGAAACTCATGGGGTATGAT
ACTTTTGACCAGTTTACTGAGGAAAGAAGAAGTTCAATTCTAACTGAGACCTTACGCAGG
TTCTCAGTAGACGATGAAGGGCATCATCACCATCACCACTGAAAGGGCATCATCACCATC
ACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
Start on protein reference sequence 388
End on protein reference sequence 673
Mutations:
Q410E; A412V; L462S; E583G; T623S

del508, E583G

Discrepancy:
None
Others:
Termini 388-673
Domain NBD1
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
ProteinPurified: Tested_Not_Purified
Find experimental protocols in 5784f
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Cftr
Symbol Nomenclature : Cftr
SYNONYM : AW495489; Abcc7
Designation : ATP-binding cassette sub-family C member 7|ATP-binding cassette transporter sub-family C member 7|ATP-binding cassette, subfamily c, member 7|cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator homolog|cystic fibrosis transmembrane conductance regulator homolog; ATP-binding cassette, subfamily c, member 7
Full Nomenclature : cystic fibrosis transmembrane conductance regulator
GENEID : 12638
GenBank Accession : NP_066388.1
Mouse Genome Informatics : 88388
Vega : OTTMUSG00000024173
Target GenBank: NP_066388.1

 

Protein

Domain : NBD1
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : P26361

Clone

Cloning Information : 474261
HIP Master Clone ID : 395767
Original Clone ID : 5784f2BCt2p1

Experimental

TargetTrack - Experimental data : 5784f

Organism


TAX_ID : 10090
Species Specific ID: 12638

Genome

Chromosome : 6
Map Location : 6 A3|6 8.1 cM
Ensembl : ENSMUSG00000041301

Reagents

Labome : Cftr-antibody