DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  LOC100136364
Gene Name:  cystic fibrosis transmembrane conductance regulator I
Sequence             
Original Clone ID: 2935a3BCt3b1
Keyword: Partial Protein, NBD1 domain
Species: Salmo salar
Type: cDNA
Vector Name: pSGX3               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 domain and corresponds to region 390-678 on full length protein AAK07405.1.
Comments: C-terminal 6-His, TOPO. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
No / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
SsCD00287531

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 894nts        
Open reading frame : 1 to 894

ACCACAGAAATTGAACTCGTGAACGTGACGGCCAGCTGGGATGAGGGCATTGGCGAACTT
TTCGAAAAAATCAAACAGGAAAATAAAGCGAACGGCCAGCCAAACGGCGACGCGGGTCTG
TTTTTTACCAACTTGTACGTCACCCCGGTGCTGAAAAATATTAGCCTTTACCTCGAGAAA
GGGCAGATGCTGGCGGTGGCAGGGTCAACGGGCAGCGGCAAATCCTCCTTACTGATGATG
ATTCTGGGTGAGCTTGTGCCTTCCGAGGGCAAGATTCGTCATTCGGGCCGGATCAGCTTT
TCCCCGCAGACTTCGTGGATTATGCCAGGCACCATTCGCGATAACATCCTTTTTGGTCTT
ACGTATGATGAATTTCGTTACACCAGTGTCATTAAGGCCTGCCAGCTGGAAGAGGATCTG
GCCTTACTGCCGGAAAAAGACAAGACCCCGCTTATGGAAGGTGGCGTCACGTTGAGCGGC
GGTCAACGCGCGCGCATCGGTCTCGCTCGTGCTGTGTACAAAGACGCAGACCTGTATCTG
CTCGACAGTCCATTCACGCATCTGGATATTGTTACCGAAAAGGAAATCTTTGAACGCTGT
CTGTGCAAACTCCTTTCTAGCAAAACGCGTATCGTCGTCACCTCGAAACTGGAACACCTG
AAACGCGCGGACAAGATCCTGTTACTGCACAACGGGGTCTGCTATTTTTACGGTTCTTTC
TCGGAACTGCAGGCCAAACGCCCGGATTTTTCTTCATTACTGTTGGGGTTAGAAGCCTAC
GACAACATCAAAGCAGAACGCCGTTCATCCATTTTGACCGAAACGCTGCGCCGCGTCTCC
ATTGACGAATCAACCGTATTCCGTGGTGAAGGGCATCATCACCATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
Start on protein reference sequence 390
End on protein reference sequence 678
Mutations:
None
Discrepancy:
None
Others:
Termini 390-678
Domain NBD1
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
ProteinPurified: Tested_Not_Purified
Find experimental protocols in 2935a
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : LOC100136364
GENEID : 100136364
GenBank Accession : AAK07405.1
Target GenBank: AAK07405.1

 

Protein

Domain : NBD1
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : Q9W750

Clone

Cloning Information : 474282
HIP Master Clone ID : 395788
Original Clone ID : 2935a3BCt3b1

Experimental

TargetTrack - Experimental data : 2935a

Organism


TAX_ID : 8030
Species Specific ID: 100136364

Reagents

Labome : LOC100136364-cDNA