DNASU Plasmid Repository • 480.965.2857 | Email

Cftr (Mus musculus) in pSGX5 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Cftr
Gene Name:  cystic fibrosis transmembrane conductance regulator
Sequence             
Original Clone ID: 2935f146CLt1p3
Keyword: Partial Protein, NBD1 domain
Species: Mus musculus
Type: cDNA
Vector Name: pSGX5               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 domain and corresponds to region 389-673 on full length protein NP_066388.1.
Comments: N-terminal 6-His-tag/SMT. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
Yes / Unknown
Publications: PMID: 14685259
Title: Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator
Authors: SGX Pharmaceuticals, Inc.
MmCD00287545

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/Smt3/SUMO

 

Insert sequence: 858nts         Open reading frame : 1 to 858

ACCACAGGCATAATCATGGAAAATGTAACAGCATTTTGGGAGGAGGGATTTGGGGAATTA
CTGGAGAAAGTACAACAAAGCAATGGTGACAGAAAACATTCCAGTGATGAGAACAATGTC
AGTTTCAGTCATCTCTGCCTTGTGGGAAATCCTGTGCTGAAAAACATCAATTTGAATATA
GAGAAAGGAGAGATGTTGGCTATTACTGGATCTACTGGATCAGGAAAGACATCACTCCTG
ATGTTGATTTTGGGAGAACTGGAAGCTTCAGAGGGAATTATTAAGCACAGTGGAAGAGTT
TCATTCTGCTCTCAATTTTCTTGGATTATGCCGGGTACTATCAAAGAAAATATCATCTTT
GGTGTTTCCTATGATGAGTACAGATATAAGAGTGTTGTCAAAGCTTGCCAACTACAGCAG
GACATCACCAAGTTTGCAGAACAAGACAACACAGTTCTTGGAGAAGGTGGAGTCACACTG
AGTGGAGGTCAGCGTGCAAGGATTTCTTTAGCAAGAGCAGTATATAAAGATGCTGATTTG
TACCTATTAGATTCCCCTTTTGGGTATCTAGATGTTTTTACTGAAGAACAAGTATTTGAA
AGCTGTGTTTGTAAATTGATGGCCAACAAAACTAGGATTTTGGTTACATCTAAAATGGAA
CACTTAAGGAAAGCTGACAAAATACTAATTTTGCATCAGGGCAGTAGCTATTTTTATGGG
ACATTTTCTGAGCTACAAAGTCTACGTCCAGACTTCAGTTCGAAACTCATGGGGTATGAT
ACTTTTGACCAGTTTACTGAGGAAAGAAGAAGTTCAATTCTAACTGAGACCTTACGCAGG
TTCTCAGTAGACGATTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
End on protein reference sequence 673
Start on protein reference sequence 389
Mutations:
Q410E; A412V; L462S; T623S; S639D

Discrepancy:
None
Others:
Domain NBD1
Termini 389-673
5' Linker Sequence:
CACAGAGAACAGATTGGTGGATCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 2935f
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX5

pSGX5 in advanced viewed

Synonyms: pSGX5
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, ULP-1 cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. Smt3 fusion at N-terminus. Clone using BamHI and either HindIII, XhoI or NotI
Size (bp): 5633
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start start codon 5071 5073
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
primer site T7 T7 sequencing primers 4985 5000
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site cds 5242 5242
repressor protein gene LacI LacI gene 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 N-terminal Smt3 tag 5140 5242
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5562 5608

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Cftr
Symbol Nomenclature : Cftr
SYNONYM : AW495489; Abcc7
Designation : ATP-binding cassette sub-family C member 7|ATP-binding cassette transporter sub-family C member 7|ATP-binding cassette, subfamily c, member 7|cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator homolog|cystic fibrosis transmembrane conductance regulator homolog; ATP-binding cassette, subfamily c, member 7
Full Nomenclature : cystic fibrosis transmembrane conductance regulator
GENEID : 12638
GenBank Accession : NP_066388.1
Mouse Genome Informatics : 88388
Vega : OTTMUSG00000024173
Target GenBank: NP_066388.1

 

Protein

Domain : NBD1
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : P26361

Clone

Cloning Information : 474296
HIP Master Clone ID : 395802
Original Clone ID : 2935f146CLt1p3

Experimental

TargetTrack - Experimental data : 2935f

Organism


TAX_ID : 10090
Species Specific ID: 12638

Genome

Chromosome : 6
Map Location : 6 A3|6 8.1 cM
Ensembl : ENSMUSG00000041301

Reagents

Labome : Cftr-antibody