DNASU Plasmid Repository • 480.965.5697 | Email

CFTR (Homo sapiens) in pSGX5 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CFTR
Gene Name:  cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Sequence             
Original Clone ID: 2935c316CLt1p1
Keyword: Partial Protein, NBD1 domain
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX5               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 domain with other intended mutations and corresponds to region 389-678 on full length protein NP_000483.3.
Comments: N-terminal 6-His-tag/SMT. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
Yes / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
HsCD00287581

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/Smt3/SUMO

 

Insert sequence: 1236nts         Open reading frame : 1 to 1236
Reference Sequence Alignment

ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT
ATGGCTAGCATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAA
GTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTC
AAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGT
AAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACC
CCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGT
GGATCAACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGG
GAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGAC
AGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTC
AAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCA
CTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGA
AGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATC
ATCGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAA
GAAGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACA
CTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAGCAGTATACAAAGATGCTGAT
TTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTT
GAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATG
GAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTAT
GGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGT
GATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACAC
CGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
Start on protein reference sequence 389
End on protein reference sequence 678
Mutations:
del508

Discrepancy:
None
Others:
Termini 389-678
Domain NBD1
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: SolubleProtein: Not_Tested
ProteinExpressed: Protein_Confirmed
ProteinPurified: Tested_Not_Purified
Find experimental protocols in 2935c
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX5

pSGX5 in advanced viewed

Synonyms: pSGX5
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, ULP-1 cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. Smt3 fusion at N-terminus. Clone using BamHI and either HindIII, XhoI or NotI
Size (bp): 5633
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start start codon 5071 5073
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
primer site T7 T7 sequencing primers 4985 5000
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site cds 5242 5242
repressor protein gene LacI LacI gene 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 N-terminal Smt3 tag 5140 5242
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5562 5608

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CFTR
Symbol Nomenclature : CFTR
SYNONYM : ABC35; ABCC7; CF; CFTR/MRP; MRP7; TNR-CFTR; dJ760C5.1
Designation : cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator
Full Nomenclature : cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
GENEID : 1080
Locus Tag : tcag7.78
GenBank Accession : NP_000483.3
HGNC : 1884
MIM : 602421
Vega : OTTHUMG00000023076
Target GenBank: NP_000483.3

 

Reference Sequence Alignment

  

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCGCG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTC
                                                                              

HsCD00287581      --------------ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGC
NM_000492.3       GTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAG
                                :* * .** .**..**.**** .  .*.* .  .*.*   * . . 

HsCD00287581      CGCGCGGCAGCCATATGGCTAGCATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAG
NM_000492.3       GCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTA
                      * **.  *: : *.**:* :*  * ** : : .:  *..* :: .**  :.* *:.

HsCD00287581      AGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTT
NM_000492.3       GGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTG
                  .**: **  .:**:*:..:.*. ...:*: * * *:.  :*.*  :** ..* . :* * 

HsCD00287581      CAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCG
NM_000492.3       ATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCA
                  .: * .**: .:: .* : .***:* .*.*    **:*.*.* .***.***.*. .: *.

HsCD00287581      CTAAAAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATTC
NM_000492.3       ATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCC
                  .*..**.*.* *.*:...**.* .* :*.::.***:   :.:. ***   .::.*.*  *

HsCD00287581      AAG---------------------------------------------------------
NM_000492.3       TATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTA
                  :*                                                          

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACA
                                                                              

HsCD00287581      -------CTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCT
NM_000492.3       TGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATAT
                         .  .**: . . *:.:*.* ::..:..:***  : ::. *:*: .::**. .*

HsCD00287581      CACAGAGAACAGATTGGTGGATCAACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
NM_000492.3       AAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
                  .* * * :. *.::*..   *:*.************************************

HsCD00287581      TGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAA
NM_000492.3       TGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAA
                  ************************************************************

HsCD00287581      ACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTC
NM_000492.3       ACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTC
                  ************************************************************

HsCD00287581      CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
NM_000492.3       CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
                  ************************************************************

HsCD00287581      GGAGCAGGCAAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGT
NM_000492.3       GGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGT
                  ***************************.********************************

HsCD00287581      AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
NM_000492.3       AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
                  ************************************************************

HsCD00287581      ACCATTAAAGAAAATATCATCGGTG---TTTCCTATGATGAATATAGATACAGAAGCGTC
NM_000492.3       ACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTC
                  *********************  **   ********************************

HsCD00287581      ATCAAAGCATGCCAACTAGAAGAAGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
NM_000492.3       ATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
                  ***********************.************************************

HsCD00287581      CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
NM_000492.3       CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
                  ************************************************************

HsCD00287581      GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
NM_000492.3       GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
                  ************************************************************

HsCD00287581      TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
NM_000492.3       TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
                  ************************************************************

HsCD00287581      ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
NM_000492.3       ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
                  ************************************************************

HsCD00287581      GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
NM_000492.3       GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
                  ************************************************************

HsCD00287581      AGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCA
NM_000492.3       AGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCA
                  ************************************************************

HsCD00287581      ATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTAA---
NM_000492.3       ATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACA
                  *******************************************************..   

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGAT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAA
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCT
                                                                              

HsCD00287581      ------------------------------------------------------------
NM_000492.3       AAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTT
                                                                              

HsCD00287581      ---
NM_000492.3       TAG
                     

Pathways

Reactome : ABC-family proteins mediated transport
Reactome : Transmembrane transport of small molecules

Protein

Domain : NBD1
SMART domain : UBQ : Ubiquitin homologues
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : P13569
HPRD : 03883

Clone

Cloning Information : 474332
HIP Master Clone ID : 395838
Original Clone ID : 2935c316CLt1p1

Experimental

TargetTrack - Experimental data : 2935c

Organism


TAX_ID : 9606
Species Specific ID: 1080

Genome

Chromosome : 7
Map Location : 7q31.2
Ensembl : ENSG00000001626

Reagents

Labome : CFTR-antibody