DNASU Plasmid Repository • 480.965.5697 | Email

SLC10A1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC10A1
Gene Name:  solute carrier family 10 (sodium/bile acid cotransporter), member 1
Sequence             
Original Clone ID: 43967
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00287982

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1050nts         Open reading frame : 1 to 1050
Reference Sequence Alignment

ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACTTTGGCAAG
CGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCATCATGCTC
TCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGCCTAAAGGG
CTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTGTGCTGGGC
AAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCTGCTCACCT
GGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACCTCAGCATT
GTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCCTGTACATC
TACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAGGCATCGTG
ATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAATCCAAACGG
CCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGTGCAGTGTG
GCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCATGACACCA
CTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTTATGTTCTC
TCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGACTGGATGC
CAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAGTCATTGGA
CCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGCTTCTCCTC
ATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAAAAATGATC
TACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCACCTACAAA
GGGGAGGACTGCTCCCCTTGCACAGCCTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1131
Start on reference sequence 82
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC10A1
Symbol Nomenclature : SLC10A1
SYNONYM : NTCP
Designation : Na(+)/bile acid cotransporter|Na(+)/taurocholate transport protein|Na/taurocholate cotransporting polypeptide|cell growth-inhibiting gene 29 protein|growth-inhibiting protein 29|sodium/bile acid cotransporter|sodium/taurocholate cotransporter|sodium/taurocholate cotransporting polypeptide|solute carrier family 10 (sodium/bile acid cotransporter family), member 1|solute carrier family 10 member 1
Full Nomenclature : solute carrier family 10 (sodium/bile acid cotransporter), member 1
GENEID : 6554
Locus Tag : GIG29
HGNC : 10905
MIM : 182396
Target GenBank: BC069822.1

 

Reference Sequence Alignment

  

HsCD00287982      ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACTTTGGCAAG
NM_003049.3       ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACTTTGGCAAG
                  ************************************************************

HsCD00287982      CGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCATCATGCTC
NM_003049.3       CGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCATCATGCTC
                  ************************************************************

HsCD00287982      TCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGCCTAAAGGG
NM_003049.3       TCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGCCTAAAGGG
                  ************************************************************

HsCD00287982      CTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTGTGCTGGGC
NM_003049.3       CTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTGTGCTGGGC
                  ************************************************************

HsCD00287982      AAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCTGCTCACCT
NM_003049.3       AAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCTGCTCACCT
                  ************************************************************

HsCD00287982      GGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACCTCAGCATT
NM_003049.3       GGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACCTCAGCATT
                  ************************************************************

HsCD00287982      GTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCCTGTACATC
NM_003049.3       GTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCCTGTACATC
                  ************************************************************

HsCD00287982      TACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAGGCATCGTG
NM_003049.3       TACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAGGCATCGTG
                  ************************************************************

HsCD00287982      ATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAATCCAAACGG
NM_003049.3       ATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAATCCAAACGG
                  ************************************************************

HsCD00287982      CCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGTGCAGTGTG
NM_003049.3       CCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGTGCAGTGTG
                  ************************************************************

HsCD00287982      GCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCATGACACCA
NM_003049.3       GCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCATGACACCA
                  ************************************************************

HsCD00287982      CTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTTATGTTCTC
NM_003049.3       CTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTTATGTTCTC
                  ************************************************************

HsCD00287982      TCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGACTGGATGC
NM_003049.3       TCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGACTGGATGC
                  ************************************************************

HsCD00287982      CAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAGTCATTGGA
NM_003049.3       CAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAGTCATTGGA
                  ************************************************************

HsCD00287982      CCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGCTTCTCCTC
NM_003049.3       CCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGCTTCTCCTC
                  ************************************************************

HsCD00287982      ATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAAAAATGATC
NM_003049.3       ATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAAAAATGATC
                  ************************************************************

HsCD00287982      TACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCACCTACAAA
NM_003049.3       TACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCACCTACAAA
                  ************************************************************

HsCD00287982      GGGGAGGACTGCTCCCCTTGCACAGCCTAC
NM_003049.3       GGGGAGGACTGCTCCCCTTGCACAGCCTAG
                  ***************************** 

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts

Protein

UniProt : Q14973
UniProt : B2RA41
HPRD : 01672

Clone

Cloning Information : 471219
HIP Master Clone ID : 394137
Original Clone ID : 43967

Organism


TAX_ID : 9606
Species Specific ID: 6554

Genome

Chromosome : 14
Map Location : 14q24.1

Reagents

Labome : SLC10A1-antibody