DNASU Plasmid Repository • 480.965.5697 | Email

ASB5 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ASB5
Gene Name:  ankyrin repeat and SOCS box containing 5
Sequence             
Original Clone ID: 54814
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288126

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 990nts         Open reading frame : 1 to 990
Reference Sequence Alignment

ATGTCGGTGTTAGAAGAAAATCGGCCGTTTGCTCAACAATTATCCAATGTCTACTTTACA
ATACTTTCGCTGTTCTGTTTTAAGCTTTTTGTGAAAATCAGCCTTGCCATCCTCAGTCAT
TTCTACATAGTGAAAGGCAACCGCAAGGAAGCGGCAAGGATAGCAGCTGAATTTTATGGA
GTAACCCAAGGACAAGGTTCCTGGGCAGATCGATCACCACTACATGAAGCAGCAAGTCAA
GGTCGCCTTCTTGCTCTGAGAACATTATTATCACAGGGTTATAATGTAAATGCAGTAACC
TTAGACCATGTCACCCCATTGCACGAAGCCTGCCTTGGAGATCACGTGGCATGTGCCAGA
ACTCTGCTGGAAGCAGGAGCTAATGTAAATGCAATCACGATAGATGGCGTGACTCCGTTA
TTCAACGCATGCTCCCAAGGCAGTCCAAGCTGTGCAGAGCTGCTTCTGGAGTATGGTGCC
AAAGCCCAGCTGGAGTCATGTCTTCCATCCCCAACGCATGAGGCCGCCAGTAAAGGTCAC
CATGAATGTCTTGACATCCTGATATCCTGGGGCATAGATGTTGACCAAGAAATTCCTCAT
TTGGGAACTCCTCTCTATGTAGCTTGTATGTCACAGCAATTCCATTGCATCTGGAAGCTT
CTTTATGCTGGTGCTGACGTACAGAAAGGCAAATATTGGGATACTCCATTACATGCTGCT
GCTCAACAATCCAGCACAGAAATTGTAAACTTACTGCTAGAATTTGGAGCAGATATCAAT
GCCAAAAATACAGAGCTTCTGCGACCTATAGATGTAGCTACGTCTAGCAGTATGGTGGAA
AGAATATTGCTTCAACATGAAGCTACCCCAAGCTCTCTTTACCAACTTTGCCGACTCTGT
ATCCGAAGCTACATAGGAAAACCAAGATTGCACCTTATCCCACAACTCCAGCTGCCAACG
TTACTGAAGAATTTCTTACAGTATCGATAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1011
Start on reference sequence 22
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ASB5
Symbol Nomenclature : ASB5
SYNONYM : ASB-5
Designation : SOCS box protein ASB-5|ankyrin repeat and SOCS box protein 5|ankyrin repeat and SOCS box-containing 5
Full Nomenclature : ankyrin repeat and SOCS box containing 5
GENEID : 140458
HGNC : 17180
MIM : 615050
Vega : OTTHUMG00000160793
Target GenBank: BC065710.1

 

Reference Sequence Alignment

  

HsCD00288126        ATGTCGGTGTTAGAAGAAAATCGGCCGTTTGCTCAACAATTATCCAATGTCTACTTTACA
XM_005262759.1      ATGTCGGTGTTAGAAGAAAATCGGCCGTTTGCTCAACAATTATCCAATGTCTACTTTACA
NM_080874.3         ATGTCGGTGTTAGAAGAAAATCGGCCGTTTGCTCAACAATTATCCAATGTCTACTTTACA
XM_005262760.1      ------------------------------------------------------------
                                                                                

HsCD00288126        ATACTTTCGCTGTTCTGTTTTAAGCTTTTTGTGAAAATCAGCCTTGCCATCCTCAGTCAT
XM_005262759.1      ATACTTTCGCTGTTCTGTTTTAAGCTTTTTGTGAAAATCAGCCTTGCCATCCTCAGTCAT
NM_080874.3         ATACTTTCGCTGTTCTGTTTTAAGCTTTTTGTGAAAATCAGCCTTGCCATCCTCAGTCAT
XM_005262760.1      ------------ATGTCCGCAGATATTGCTGTTGAAATGAACTGCATTAAGCAGGTCCTC
                                :* *    :.* .**  *** .**** *.*   .  *: *: .  *: 

HsCD00288126        TTCTACATAGTGAAAGGCAACCGCAAGGAAGCGGCAAGGATAGCAGCTGAATTTTATGGA
XM_005262759.1      TTCTACATAGTGAAAGGCAACCGCAAGGAAGCGGCAAGGATAGCAGCTGAATTTTATGGA
NM_080874.3         TTCTACATAGTGAAAGGCAACCGCAAGGAAGCGGCAAGGATAGCAGCTGAATTTTATGGA
XM_005262760.1      ACGAAAAGAAGGCTAGTGAGTATAGAGGAATGTTCTTCTAAACGAAAAGCTAGCTGGGGT
                    :  :*.* *. *.:**  *. . ..*****    *::  *:*  *..:*.::  *. **:

HsCD00288126        GTAACCCAAGGACAAGGTTCCTGGGCAGATCGATCACCACTACATGAAGCAGCAAGTCAA
XM_005262759.1      GTAACCCAAGGACAAGGTTCCTGGGCAGATCGATCACCACTACATGAAGCAGCAAGTCAA
NM_080874.3         GTAACCCAAGGACAAGGTTCCTGGGCAGATCGATCACCACTACATGAAGCAGCAAGTCAA
XM_005262760.1      ATTCTGACCAGTCAAGGTTCCTGGGCAGATCGATCACCACTACATGAAGCAGCAAGTCAA
                    .*:.  ....*:************************************************

HsCD00288126        GGTCGCCTTCTTGCTCTGAGAACATTATTATCACAGGGTTATAATGTAAATGCAGTAACC
XM_005262759.1      GGTCGCCTTCTTGCTCTGAGAACATTATTATCACAGGGTTATAATGTAAATGCAGTAACC
NM_080874.3         GGTCGCCTTCTTGCTCTGAGAACATTATTATCACAGGGTTATAATGTAAATGCAGTAACC
XM_005262760.1      GGTCGCCTTCTTGCTCTGAGAACATTATTATCACAGGGTTATAATGTAAATGCAGTAACC
                    ************************************************************

HsCD00288126        TTAGACCATGTCACCCCATTGCACGAAGCCTGCCTTGGAGATCACGTGGCATGTGCCAGA
XM_005262759.1      TTAGACCATGTCACCCCATTGCACGAAGCCTGCCTTGGAGATCACGTGGCATGTGCCAGA
NM_080874.3         TTAGACCATGTCACCCCATTGCACGAAGCCTGCCTTGGAGATCACGTGGCATGTGCCAGA
XM_005262760.1      TTAGACCATGTCACCCCATTGCACGAAGCCTGCCTTGGAGATCACGTGGCATGTGCCAGA
                    ************************************************************

HsCD00288126        ACTCTGCTGGAAGCAGGAGCTAATGTAAATGCAATCACGATAGATGGCGTGACTCCGTTA
XM_005262759.1      ACTCTGCTGGAAGCAGGAGCTAATGTAAATGCAATCACGATAGATGGCGTGACTCCGTTA
NM_080874.3         ACTCTGCTGGAAGCAGGAGCTAATGTAAATGCAATCACGATAGATGGCGTGACTCCGTTA
XM_005262760.1      ACTCTGCTGGAAGCAGGAGCTAATGTAAATGCAATCACGATAGATGGCGTGACTCCGTTA
                    ************************************************************

HsCD00288126        TTCAACGCATGCTCCCAAGGCAGTCCAAGCTGTGCAGAGCTGCTTCTGGAGTATGGTGCC
XM_005262759.1      TTCAACGCATGCTCCCAAGGCAGTCCAAGCTGTGCAGAGCTGCTTCTGGAGTATGGTGCC
NM_080874.3         TTCAACGCATGCTCCCAAGGCAGTCCAAGCTGTGCAGAGCTGCTTCTGGAGTATGGTGCC
XM_005262760.1      TTCAACGCATGCTCCCAAGGCAGTCCAAGCTGTGCAGAGCTGCTTCTGGAGTATGGTGCC
                    ************************************************************

HsCD00288126        AAAGCCCAGCTGGAGTCATGTCTTCCATCCCCAACGCATGAGGCCGCCAGTAAAGGTCAC
XM_005262759.1      AAAGCCCAGCTGGAGTCATGTCTTCCATCCCCAACGCATGAGGCCGCCAGTAAAGGTCAC
NM_080874.3         AAAGCCCAGCTGGAGTCATGTCTTCCATCCCCAACGCATGAGGCCGCCAGTAAAGGTCAC
XM_005262760.1      AAAGCCCAGCTGGAGTCATGTCTTCCATCCCCAACGCATGAGGCCGCCAGTAAAGGTCAC
                    ************************************************************

HsCD00288126        CATGAATGTCTTGACATCCTGATATCCTGGGGCATAGATGTTGACCAAGAAATTCCTCAT
XM_005262759.1      CATGAATGTCTTGACATCCTGATATCCTGGGGCATAGATGTTGACCAAGAAATTCCTCAT
NM_080874.3         CATGAATGTCTTGACATCCTGATATCCTGGGGCATAGATGTTGACCAAGAAATTCCTCAT
XM_005262760.1      CATGAATGTCTTGACATCCTGATATCCTGGGGCATAGATGTTGACCAAGAAATTCCTCAT
                    ************************************************************

HsCD00288126        TTGGGAACTCCTCTCTATGTAGCTTGTATGTCACAGCAATTCCATTGCATCTGGAAGCTT
XM_005262759.1      TTGGGAACTCCTCTCTATGTAGCTTGTATGTCACAGCAATTCCATTGCATCTGGAAGCTT
NM_080874.3         TTGGGAACTCCTCTCTATGTAGCTTGTATGTCACAGCAATTCCATTGCATCTGGAAGCTT
XM_005262760.1      TTGGGAACTCCTCTCTATGTAGCTTGTATGTCACAGCAATTCCATTGCATCTGGAAGCTT
                    ************************************************************

HsCD00288126        CTTTATGCTGGTGCTGACGTACAGAAAGGCAAATATTGGGATACTCCATTACATGCTGCT
XM_005262759.1      CTTTATGCTGGTGCTGACGTACAGAAAGGCAAATATTGGGATACTCCATTACATGCTGCT
NM_080874.3         CTTTATGCTGGTGCTGACGTACAGAAAGGCAAATATTGGGATACTCCATTACATGCTGCT
XM_005262760.1      CTTTATGCTGGTGCTGACGTACAGAAAGGCAAATATTGGGATACTCCATTACATGCTGCT
                    ************************************************************

HsCD00288126        GCTCAACAATCCAGCACAGAAATTGTAAACTTACTGCTAGAATTTGGAGCAGATATCAAT
XM_005262759.1      GCTCAACAATCCAGCACAGAAATTGTAAACTTACTGCTAGAATTTGGAGCAGATATCAAT
NM_080874.3         GCTCAACAATCCAGCACAGAAATTGTAAACTTACTGCTAGAATTTGGAGCAGATATCAAT
XM_005262760.1      GCTCAACAATCCAGCACAGAAATTGTAAACTTACTGCTAGAATTTGGAGCAGATATCAAT
                    ************************************************************

HsCD00288126        GCCAAAAATACAGAGCTTCTGCGACCTATAGATGTAGCTACGTCTAGCAGTATGGTGGAA
XM_005262759.1      GCCAAAAATACAGAGCTTCTGCGACCTATAGATGTAGCTACGTCTAGCAGTATGGTGGAA
NM_080874.3         GCCAAAAATACAGAGCTTCTGCGACCTATAGATGTAGCTACGTCTAGCAGTATGGTGGAA
XM_005262760.1      GCCAAAAATACAGAGCTTCTGCGACCTATAGATGTAGCTACGTCTAGCAGTATGGTGGAA
                    ************************************************************

HsCD00288126        AGAATATTGCTTCAACATGAAGCTACCCCAAGCTCTCTTTACCAACTTTGCCGACTCTGT
XM_005262759.1      AGGATATTGCTTCAACATGAAGCTACCCCAAGCTCTCTTTACCAACTTTGCCGACTCTGT
NM_080874.3         AGGATATTGCTTCAACATGAAGCTACCCCAAGCTCTCTTTACCAACTTTGCCGACTCTGT
XM_005262760.1      AGGATATTGCTTCAACATGAAGCTACCCCAAGCTCTCTTTACCAACTTTGCCGACTCTGT
                    **.*********************************************************

HsCD00288126        ATCCGAAGCTACATAGGAAAACCAAGATTGCACCTTATCCCACAACTCCAGCTGCCAACG
XM_005262759.1      ATCCGAAGCTACATAGGAAAACCAAGATTGCACCTTATCCCACAACTCCAGCTGCCAACG
NM_080874.3         ATCCGAAGCTACATAGGAAAACCAAGATTGCACCTTATCCCACAACTCCAGCTGCCAACG
XM_005262760.1      ATCCGAAGCTACATAGGAAAACCAAGATTGCACCTTATCCCACAACTCCAGCTGCCAACG
                    ************************************************************

HsCD00288126        TTACTGAAGAATTTCTTACAGTATCGATAC
XM_005262759.1      TTACTGAAGAATTTCTTACAGTATCGATAA
NM_080874.3         TTACTGAAGAATTTCTTACAGTATCGATAA
XM_005262760.1      TTACTGAAGAATTTCTTACAGTATCGATAA
                    *****************************.

Pathways

Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Immune System

Protein

SMART domain : SOCS_box :
SMART domain : ANK : ankyrin repeats
UniProt : Q8WWX0
UniProt : Q5HYF3
HPRD : 10672

Clone

Cloning Information : 471363
HIP Master Clone ID : 394281
Original Clone ID : 54814

Organism


TAX_ID : 9606
Species Specific ID: 140458

Genome

Chromosome : 4
Map Location : 4q34.2
Ensembl : ENSG00000164122

Reagents

Labome : ASB5-antibody