DNASU Plasmid Repository • 480.965.5697 | Email

C1QA (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  C1QA
Gene Name:  complement component 1, q subcomponent, A chain
Sequence             
Original Clone ID: 39524
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288264

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 738nts         Open reading frame : 1 to 738
Reference Sequence Alignment

ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAA
GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
ATCTTCCCATCTGCCTGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 793
Start on reference sequence 56
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : C1QA
Symbol Nomenclature : C1QA
Designation : complement C1q subcomponent subunit A|complement component 1, q subcomponent, alpha polypeptide|complement component C1q, A chain
Full Nomenclature : complement component 1, q subcomponent, A chain
GENEID : 712
HGNC : 1241
MIM : 120550
Vega : OTTHUMG00000002893
Target GenBank: BC030153.2

 

Reference Sequence Alignment

  

HsCD00288264      ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
NM_015991.2       ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
                  ************************************************************

HsCD00288264      GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
NM_015991.2       GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
                  ************************************************************

HsCD00288264      AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
NM_015991.2       AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
                  ************************************************************

HsCD00288264      ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
NM_015991.2       ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
                  ************************************************************

HsCD00288264      AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAA
NM_015991.2       AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGAGCCCGTGGCATCCCGGGAATTAAA
                  ***********************************.************************

HsCD00288264      GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
NM_015991.2       GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
                  ************************************************************

HsCD00288264      CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
NM_015991.2       CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
                  ************************************************************

HsCD00288264      GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
NM_015991.2       GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
                  ************************************************************

HsCD00288264      TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
NM_015991.2       TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
                  ************************************************************

HsCD00288264      GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
NM_015991.2       GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
                  ************************************************************

HsCD00288264      GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
NM_015991.2       GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
                  ************************************************************

HsCD00288264      CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
NM_015991.2       CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
                  ************************************************************

HsCD00288264      ATCTTCCCATCTGCCTGC
NM_015991.2       ATCTTCCCATCTGCCTGA
                  *****************.

Pathways

Reactome : Classical antibody-mediated complement activation
Reactome : Complement cascade
Reactome : Creation of C4 and C2 activators
Reactome : Immune System
Reactome : Initial triggering of complement
Reactome : Innate Immune System
WikiPathway : Complement Activation, Classical Pathway
WikiPathway : Complement and Coagulation Cascades

Protein

SMART domain : C1Q : Complement component C1q domain.
UniProt : P02745
HPRD : 00393

Clone

Cloning Information : 471501
HIP Master Clone ID : 394419
Original Clone ID : 39524

Organism


TAX_ID : 9606
Species Specific ID: 712

Genome

Chromosome : 1
Map Location : 1p36.12
Ensembl : ENSG00000173372

Reagents

Labome : C1QA-antibody