DNASU Plasmid Repository • 480.965.5697 | Email

U2AF1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  U2AF1
Gene Name:  U2 small nuclear RNA auxiliary factor 1
Sequence             
Original Clone ID: 40625
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288302

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 504nts         Open reading frame : 1 to 504

ATGCAGGAACACTATGATGAGTTTTTTGAGGAGGTTTTTACAGAAATGGAGGAGAAGTAT
AGGGAAGTAGAGGAGATGAACGTCTGTGACAACCTGGGAGACCACCTGGTGGGGAACGTG
TACGTCAAGTTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGT
TGGTTTAATGGACAGCCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCC
TGCTGCCGTCAGTATGAGATGGGAGAATGCACACGAGGCGGCTTCTGCAACTTCATGCAT
TTGAAGCCCATTTCCAGAGAGCTGCGGCGGGAGCTGTATGGCCGCCGTCGCAAGAAGCAT
AGATCAAGATCCCGATCCCGGGAGCGTCGTTCTCGGTCTAGAGACCGTGGTCGTGGCGGT
GGCGGTGGCGGTGGTGGAGGTGGCGGCGGACGGGAGCGTGACAGGAGGCGGTCGAGAGAT
CGTGAAAGATCTGGGCGATTCTGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 820
Start on reference sequence 317
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : U2AF1
Symbol Nomenclature : U2AF1
SYNONYM : FP793; RN; RNU2AF1; U2AF35; U2AFBP
Designation : U2 small nuclear RNA auxillary factor 1|U2 small nuclear ribonucleoprotein auxillary factor, 35-KD subunit|U2 snRNP auxiliary factor small subunit|U2(RNU2) small nuclear RNA auxiliary factor binding protein|splicing factor U2AF 35 kDa subunit|splicing factor U2AF 35kDa subunit
Full Nomenclature : U2 small nuclear RNA auxiliary factor 1
GENEID : 7307
HGNC : 12453
MIM : 191317
Vega : OTTHUMG00000086836
Target GenBank: BC005915.1

 

Pathways

Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Gene Expression
Reactome : Post-Elongation Processing of Intron-Containing pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Termination
Reactome : Transcription
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNA derived from an Intron-Containing Transcript
Reactome : mRNA 3'-end processing
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
WikiPathway : mRNA processing

Protein

SMART domain : RRM_1 : RNA recognition motif
SMART domain : ZnF_C3H1 : zinc finger
UniProt : Q7Z780
UniProt : Q701P4
UniProt : Q71RF1
UniProt : Q01081
HPRD : 01871

Clone

Cloning Information : 471539
HIP Master Clone ID : 394457
Original Clone ID : 40625

Organism


TAX_ID : 9606
Species Specific ID: 7307

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000160201

Reagents

Labome : U2AF1-antibody