DNASU Plasmid Repository • 480.965.5697 | Email

GPSM3 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GPSM3
Gene Name:  G-protein signaling modulator 3
Sequence             
Original Clone ID: 23265
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288509

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 483nts         Open reading frame : 1 to 483
Reference Sequence Alignment

ATGGAGGCTGAGAGACCCCAGGAAGAAGAGGATGGTGAGCAGGGCCCCCCTCAGGATGAG
GAAGGCTGGCCCCCTCCAAACTCCACCACTCGGCCTTGGCGATCTGCTCCTCCATCCCCT
CCTCCTCCAGGGACCCGCCACACAGCCCTGGGACCCCGCTCGGCCTCCCTGCTCTCCCTG
CAGACTGAACTCCTTCTGGACCTGGTGGCTGAAGCCCAGTCCCGCCGCCTGGAGGAGCAG
AGGGCCACCTTCTACACCCCCCAAAACCCCTCAAGCCTAGCCCCTGCCCCACTCCGTCCT
CTCGAGGACAGAGAACAGCTTTACAGCACTATCCTCAGTCACCAGTGCCAGCGGATGGAA
GCCCAGCGGTCAGAGCCTCCCCTCCCTCCAGGGGGGCAAGAGCTCCTGGAGTTGCTGCTG
AGAGTTCAGGGTGGGGGTCGAATGGAGGAGCAAAGGTCCCGGCCCCCCACACACACCTGC
TGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 548
Start on reference sequence 66
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GPSM3
Symbol Nomenclature : GPSM3
SYNONYM : AGS4; C6orf9; G18; G18.1a; G18.1b; G18.2; NG1
Designation : G-protein signaling modulator 3 (AGS3-like, C. elegans)|G-protein signalling modulator 3 (AGS3-like, C. elegans)|G-protein-signaling modulator 3|activator of G-protein signaling 4
Full Nomenclature : G-protein signaling modulator 3
GENEID : 63940
Locus Tag : DAAP-218M18.6
HGNC : 13945
Vega : OTTHUMG00000031244
Target GenBank: BC018724.1

 

Reference Sequence Alignment

  

HsCD00288509        ATGGAGGCTGAGAGACCCCAGGAAGAAGAGGATGGTGAGCAGGGCCCCCCTCAGGATGAG
NM_022107.1         ATGGAGGCTGAGAGACCCCAGGAAGAAGAGGATGGTGAGCAGGGCCCCCCTCAGGATGAG
NM_001276501.1      ATGGAGGCTGAGAGACCCCAGGAAGAAGAGGATGGTGAGCAGGGCCCCCCTCAGGATGAG
                    ************************************************************

HsCD00288509        GAAGGCTGGCCCCCTCCAAACTCCACCACTCGGCCTTGGCGATCTGCTCCTCCATCCCCT
NM_022107.1         GAAGGCTGGCCCCCTCCAAACTCCACCACTCGGCCTTGGCGATCTGCTCCTCCATCCCCT
NM_001276501.1      GAAGGCTGGCCCCCTCCAAACTCCACCACTCGGCCTTGGCGATCTGCTCCTCCATCCCCT
                    ************************************************************

HsCD00288509        CCTCCTCCAGGGACCCGCCACACAGCCCTGGGACCCCGCTCGGCCTCCCTGCTCTCCCTG
NM_022107.1         CCTCCTCCAGGGACCCGCCACACAGCCCTGGGACCCCGCTCGGCCTCCCTGCTCTCCCTG
NM_001276501.1      CCTCCTCCAGGGACCCGCCACACAGCCCTGGGACCCCGCTCGGCCTCCCTGCTCTCCCTG
                    ************************************************************

HsCD00288509        CAGACTGAACTCCTTCTGGACCTGGTGGCTGAAGCCCAGTCCCGCCGCCTGGAGGAGCAG
NM_022107.1         CAGACTGAACTCCTTCTGGACCTGGTGGCTGAAGCCCAGTCCCGCCGCCTGGAGGAGCAG
NM_001276501.1      CAGACTGAACTCCTTCTGGACCTGGTGGCTGAAGCCCAGTCCCGCCGCCTGGAGGAGCAG
                    ************************************************************

HsCD00288509        AGGGCCACCTTCTACACCCCCCAAAACCCCTCAAGCCTAGCCCCTGCCCCACTCCGTCCT
NM_022107.1         AGGGCCACCTTCTACACCCCCCAAAACCCCTCAAGCCTAGCCCCTGCCCCACTCCGTCCT
NM_001276501.1      AGGGCCACCTTCTACACCCCCCAAAACCCCTCAAGCCTAGCCCCTGCCCCACTCCGTCCT
                    ************************************************************

HsCD00288509        CTCGAGGACAGAGAACAGCTTTACAGCACTATCCTCAGTCACCAGTGCCAGCGGATGGAA
NM_022107.1         CTCGAGGACAGAGAACAGCTTTACAGCACTATCCTCAGTCACCAGTGCCAGCGGATGGAA
NM_001276501.1      CTCGAGGACAGAGAACAGCTTTACAGCACTATCCTCAGTCACCAGTGCCAGCGGATGGAA
                    ************************************************************

HsCD00288509        GCCCAGCGGTCAGAGCCTCCCCTCCCTCCAGGGGGGCAAGAGCTCCTGGAGTTGCTGCTG
NM_022107.1         GCCCAGCGGTCAGAGCCTCCCCTCCCTCCAGGGGGGCAAGAGCTCCTGGAGTTGCTGCTG
NM_001276501.1      GCCCAGCGGTCAGAGCCTCCCCTCCCTCCAGGGGGGCAAGAGCTCCTGGAGTTGCTGCTG
                    ************************************************************

HsCD00288509        AGAGTTCAGGGTGGGGGTCGAATGGAGGAGCAAAGGTCCCGGCCCCCCACACACACCTGC
NM_022107.1         AGAGTTCAGGGTGGGGGTCGAATGGAGGAGCAAAGGTCCCGGCCCCCCACACACACCTGC
NM_001276501.1      AGAGTTCAGGGTGGGGGTCGAATGGAGGAGCAAAGGTCCCGGCCCCCCACACACACCTGC
                    ************************************************************

HsCD00288509        TGC
NM_022107.1         TGA
NM_001276501.1      TGA
                    **.

Protein

SMART domain : GoLoco : LGN motif, putative GEFs specific for G-alpha GTPases
UniProt : Q9Y4H4
UniProt : A2BFJ3
HPRD : 13605

Clone

Cloning Information : 471746
HIP Master Clone ID : 394664
Original Clone ID : 23265

Organism


TAX_ID : 9606
Species Specific ID: 63940

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000213654

Reagents

Labome : G18-antibody