DNASU Plasmid Repository • 480.965.5697 | Email

CA4 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CA4
Gene Name:  carbonic anhydrase IV
Sequence             
Original Clone ID: 25420
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288565

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 939nts         Open reading frame : 1 to 939
Reference Sequence Alignment

ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAG
TCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTC
AAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAG
GCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACG
TGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATT
TCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGAC
TTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCAC
ATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAA
GACGAAATTGCGGTGCTGGCCTTTCTGGTGGAGGCTGGAACCCAGGTGAACGAGGGCTTC
CAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGCACTACGATGGCA
GAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCACTACTTCCGCTAC
CTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACTGTGTTCCGGGAG
CCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTGTACTACGACAAG
GAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTGGGGCAGCGCACG
GTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCTGCCCTGCTGGGC
CCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1038
Start on reference sequence 100
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CA4
Symbol Nomenclature : CA4
SYNONYM : CAIV; Car4; RP17
Designation : CA-IV|carbonate dehydratase IV|carbonic anhydrase 4|carbonic dehydratase IV
Full Nomenclature : carbonic anhydrase IV
GENEID : 762
HGNC : 1375
MIM : 114760
Vega : OTTHUMG00000179987
Target GenBank: BC057792.1

 

Reference Sequence Alignment

  

HsCD00288565        ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAG
NM_000717.3         ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAG
XM_005257639.1      ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAG
                    ************************************************************

HsCD00288565        TCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTC
NM_000717.3         TCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTC
XM_005257639.1      TCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTC
                    ************************************************************

HsCD00288565        AAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAG
NM_000717.3         AAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAG
XM_005257639.1      AAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAG
                    ************************************************************

HsCD00288565        GCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACG
NM_000717.3         GCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACG
XM_005257639.1      GCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACG
                    ************************************************************

HsCD00288565        TGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATT
NM_000717.3         TGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATT
XM_005257639.1      TGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATT
                    ************************************************************

HsCD00288565        TCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGAC
NM_000717.3         TCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGAC
XM_005257639.1      TCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGAC
                    ************************************************************

HsCD00288565        TTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCAC
NM_000717.3         TTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCAC
XM_005257639.1      TTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCAC
                    ************************************************************

HsCD00288565        ATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAA
NM_000717.3         ATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAA
XM_005257639.1      ATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAA
                    ************************************************************

HsCD00288565        GACGAAATTGCGGTGCTGGCCTTTCTGGTG------------------------------
NM_000717.3         GACGAAATTGCGGTGCTGGCCTTTCTGGTG------------------------------
XM_005257639.1      GACGAAATTGCGGTGCTGGCCTTTCTGGTGGAGATCGGGAGAATGAACTGGCCACCACCA
                    ******************************                              

HsCD00288565        ------------------------------------------GAGGCTGGAACCCAGGTG
NM_000717.3         ------------------------------------------GAGGCTGGAACCCAGGTG
XM_005257639.1      CTGGCTCCCTGCAGACTTTCTCAAGACCCTTCCCTCCCTTTCCAGGCTGGAACCCAGGTG
                                                               *****************

HsCD00288565        AACGAGGGCTTCCAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGC
NM_000717.3         AACGAGGGCTTCCAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGC
XM_005257639.1      AACGAGGGCTTCCAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGC
                    ************************************************************

HsCD00288565        ACTACGATGGCAGAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCAC
NM_000717.3         ACTACGATGGCAGAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCAC
XM_005257639.1      ACTACGATGGCAGAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCAC
                    ************************************************************

HsCD00288565        TACTTCCGCTACCTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACT
NM_000717.3         TACTTCCGCTACCTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACT
XM_005257639.1      TACTTCCGCTACCTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACT
                    ************************************************************

HsCD00288565        GTGTTCCGGGAGCCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTG
NM_000717.3         GTGTTCCGGGAGCCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTG
XM_005257639.1      GTGTTCCGGGAGCCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTG
                    ************************************************************

HsCD00288565        TACTACGACAAGGAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTG
NM_000717.3         TACTACGACAAGGAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTG
XM_005257639.1      TACTACGACAAGGAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTG
                    ************************************************************

HsCD00288565        GGGCAGCGCACGGTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCT
NM_000717.3         GGGCAGCGCACGGTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCT
XM_005257639.1      GGGCAGCGCACGGTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCT
                    ************************************************************

HsCD00288565        GCCCTGCTGGGCCCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGC
NM_000717.3         GCCCTGCTGGGCCCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGA
XM_005257639.1      GCCCTGCTGGGCCCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGA
                    **************************************************.

Pathways

Reactome : Erythrocytes take up carbon dioxide and release oxygen
Reactome : Erythrocytes take up oxygen and release carbon dioxide
Reactome : Metabolism
Reactome : O2/CO2 exchange in erythrocytes
Reactome : Reversible hydration of carbon dioxide

Protein

SMART domain : Carb_anhydrase : Eukaryotic-type carbonic anhydrase
UniProt : P22748
UniProt : Q6FHI7
HPRD : 00261

Clone

Cloning Information : 471802
HIP Master Clone ID : 394720
Original Clone ID : 25420

Organism


TAX_ID : 9606
Species Specific ID: 762

Genome

Chromosome : 17
Map Location : 17q23
Ensembl : ENSG00000167434