DNASU Plasmid Repository • 480.965.5697 | Email

SCP2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SCP2
Gene Name:  sterol carrier protein 2
Sequence             
Original Clone ID: 38778
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288637

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 969nts         Open reading frame : 1 to 969
Reference Sequence Alignment

ATGTCCTCTTCCCCGTGGGAGCCTGCGACCCTGCGCCGGGTGTTCGTGGTGGGGGTTGGC
ATGACCAAGTTTGTGAAGCCTGGAGCTGAGAATTCAAGAGACTACCCTGACTTGGCAGAA
GAAGCAGGCAAGAAGGCTTTAGCTGATGCACAGATCCCTTATTCAGCAGTGGACCAGGCA
TGTGTTGGCTATGTTTTTGGTGTGGCAGAATGTGTCTTGGCTCTTGGGTTTGAGAAGATG
AGTAAGGGAAGCCTTGGAATAAAATTTTCAGATAGAACCATTCCCACTGATAAGCATGTT
GACCTCCTGATCAATAAGTATGGATTGTCTGCTCACCCAGTTGCTCCTCAGATGTTTGGG
TATGCTGGAAAAGAACATATGGAAAAATATGGAACAAAAATTGAACACTTTGCAAAAATT
GGATGGAAAAATCATAAACATTCAGTTAATAACCCGTATTCCCAGTTCCAAGATGAATAC
AGTTTAGATGAAGTGATGGCATCTAAAGAAGTTTTTGATTTTTTGACTATCTTACAATGT
TGTCCCACTTCAGATGGTGCTGCAGCAGCAATTTTGGCCAGTGAAGCATTTGTACAGAAG
TATGGCCTGCAATCCAAAGCTGTGGAAATTTTGGCACAAGAAATGATGACTGATTTGCCA
AGCTCGTTTGAAGAAAAAAGCATTATTAAAATGGTTGGCTTTGATATGAGTAAAGAAGCT
GCAAGAAAATGCTATGAGAAATCTGGCCTGACACCAAATGATATTGACGTAATAGAACTT
CACGATTGCTTTTCTACCAACGAACTCCTTACTTATGAAGCACTGGGACTCTGTCCAGAA
GGACAAGGTGCAACGCTGGTTGATAGAGGAGATAATACATATGGAGGAAAGTGGGTCATA
AATCCTAGTGGTGGACTGATTTCAAAGGGACACCCACTAGGCGCTACAGGAGGACATTCC
TGCTCTTGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1048
Start on reference sequence 80
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SCP2
Symbol Nomenclature : SCP2
SYNONYM : NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
Designation : non-specific lipid-transfer protein|propanoyl-CoA C-acyltransferase|sterol carrier protein X
Full Nomenclature : sterol carrier protein 2
GENEID : 6342
HGNC : 10606
MIM : 184755
Vega : OTTHUMG00000008936
Target GenBank: BC067108.1

 

Reference Sequence Alignment

  

HsCD00288637        ATGTCCTCTTCCCCGTGGGAGCCTGCGACCCTGCGCCGGGTGTTCGTGGTGGGGGTTGGC
NM_001193617.1      ------------------------------------------------------------
NM_001007098.2      ATGTCCTCTTCCCCGTGGGAGCCTGCGACCCTGCGCCGGGTGTTCGTGGTGGGGGTTGGC
NM_001193600.1      ATGTCCTCTTCCCCGTGGGAGCCTGCGACCCTGCGCCGGGTGTTCGTGGTGGGGGTTGGC
                                                                                

HsCD00288637        ATGACCAAGTTTGTGAAGCCTGGAGCTGAGAATTCAAGAGACTACCCTGACTTGGCAGAA
NM_001193617.1      ---------------------------------------------------ATGACTGGA
NM_001007098.2      ATGACCAAGTTTGTGAAGCCTGGAGCTGAGAATTCAAGAGACTACCCTGACTTGGCAGAA
NM_001193600.1      ATGACCAAGTTTGTGAAGCCTGGAGCTGAGAATTCAAGAGACTACCCTGACTTGGCAGAA
                                                                       :**.*:*.*

HsCD00288637        GAAGCAGGCAAGAAGGCTTTAGCTGATGCACAGATCCCTTATTCAGCAGTGGACCAGGCA
NM_001193617.1      ATTCCTATAATCAATGTCAACAATAACTGTGCTACTGGTTCTACTGCTTTGTTTATGGCC
NM_001007098.2      GAAGCAGGCAAGAAGGCTTTAGCTGATGCACAGATCCCTTATTCAGCAGTGGACCAGGCA
NM_001193600.1      GAAGCAGGCAAGAAGGCTTTAGCTGATGCACAGATCCCTTATTCAGCAGTGGACCAGGCA
                    .:: *:. .*: ** *  ::...*.*   : . *    **.*:*:**: ** : .:***.

HsCD00288637        TGTGTTGGCTATGTTTTTGGTGTGGCAGAATGTGTCTTGGCTCTTGGGTTTGAGAAGATG
NM_001193617.1      CGCCAGCTGATTCAGGGTGGTGTGGCAGAATGTGTCTTGGCTCTTGGGTTTGAGAAGATG
NM_001007098.2      TGTGTTGGCTATGTTTTTGGTGTGGCAGAATGTGTCTTGGCTCTTGGGTTTGAGAAGATG
NM_001193600.1      TGTGTTGGCTATGTTTTTGGTGTGGCAGAATGTGTCTTGGCTCTTGGGTTTGAGAAGATG
                     *  :    ::* :   *******************************************

HsCD00288637        AGTAAGGGAAGCCTTGGAATAAAATTTTCAGATAGAACCATTCCCACTGATAAGCATGTT
NM_001193617.1      AGTAAGGGAAGCCTTGGAATAAAATTTTCAGATAGAACCATTCCCACTGATAAGCATGTT
NM_001007098.2      AGTAAGGGAAGCCTTGGAATAAAATTTTCAGATAGAACCATTCCCACTGATAAGCATGTT
NM_001193600.1      AGTAAGGGAAGCCTTGGAATAAAATTTTCAGATAGAACCATTCCCACTGATAAGCATGTT
                    ************************************************************

HsCD00288637        GACCTCCTGATCAATAAGTATGGATTGTCTGCTCACCCAGTTGCTCCTCAGATGTTTGGG
NM_001193617.1      GACCTCCTGATCAATAAGTATGGATTGTCTGCTCACCCAGTTGCTCCTCAGATGTTTGGG
NM_001007098.2      GACCTCCTGATCAATAAGTATGGATTGTCTGCTCACCCAGTTGCTCCTCAGATGTTTGGG
NM_001193600.1      GACCTCCTGATCAATAAGTATGGATTGTCTGCTCACCCAGTTGCTCCTCAGATGTTTGGG
                    ************************************************************

HsCD00288637        TATGCTGGAAAAGAACATATGGAAAAATATGGAACAAAAATTGAACACTTTGCAAAAATT
NM_001193617.1      TATGCTGGAAAAGAACATATGGAAAAATATGGAACAAAAATTGAACACTTTGCAAAAATT
NM_001007098.2      TATGCTGGAAAAGAACATATGGAAAAATATGGAACAAAAATTGAACACTTTGCAAAAATT
NM_001193600.1      TATGCTGGAAAAGAACATATGGAAAAATATGGAACAAAAATTGAACACTTTGCAAAAATT
                    ************************************************************

HsCD00288637        GGATGGAAAAATCATAAACATTCAGTTAATAACCCGTATTCCCAGTTCCAAGATGAATAC
NM_001193617.1      GGATGGAAAAATCATAAACATTCAGTTAATAACCCGTATTCCCAGTTCCAAGATGAATAC
NM_001007098.2      GGATGGAAAAATCATAAACATTCAGTTAATAACCCGTATTCCCAGTTCCAAGATGAATAC
NM_001193600.1      GGATGGAAAAATCATAAACATTCAGTTAATAACCCGTATTCCCAGTTCCAAGATGAATAC
                    ************************************************************

HsCD00288637        AGTTTAGATGAAGTGATGGCATCTAAAGAAGTTTTTGATTTTTTGACTATCTTACAATGT
NM_001193617.1      AGTTTAGATGAAGTGATGGCATCTAAAGAAGTTTTTGATTTTTTGACTATCTTACAATGT
NM_001007098.2      AGTTTAGATGAAGTGATGGCATCTAAAGAAGTTTTTGATTTTTTGACTATCTTACAATGT
NM_001193600.1      AGTTTAGATGAAGTGATGGCATCTAAAGAAGTTTTTGATTTTTTGACTATCTTACAATGT
                    ************************************************************

HsCD00288637        TGTCCCACTTCAGATGGTGCTGCAGCAGCAATTTTGGCCAGTGAAGCATTTGTACAGAAG
NM_001193617.1      TGTCCCACTTCAGATGGTGCTGCAGCAGCAATTTTGGCCAGTGAAGCATTTGTACAGAAG
NM_001007098.2      TGTCCCACTTCAGATGGTGCTGCAGCAGCAATTTTGGCCAGTGAAGCATTTGTACAGAAG
NM_001193600.1      TGTCCCACTTCAGATGGTGCTGCAGCAGCAATTTTGGCCAGTGAAGCATTTGTACAGAAG
                    ************************************************************

HsCD00288637        TATGGCCTGCAATCCAAAGCTGTGGAAATTTTGGCACAAGAAATGATGACTGATTTGCCA
NM_001193617.1      TATGGCCTGCAATCCAAAGCTGTGGAAATTTTGGCACAAGAAATGATGACTGATTTGCCA
NM_001007098.2      TATGGCCTGCAATCCAAAGCTGTGGAAATTTTGGCACAAGAAATGATGACTGATTTGCCA
NM_001193600.1      TATGGCCTGCAATCCAAAGCTGTGGAAATTTTGGCACAAGAAATGATGACTGATTTGCCA
                    ************************************************************

HsCD00288637        AGCTCGTTTGAAGAAAAAAGCATTATTAAAATGGTTGGCTTTGATATGAGTAAAGAAGCT
NM_001193617.1      AGCTCGTTTGAAGAAAAAAGCATTATTAAAATGGTTGGCTTTGATATGAGTAAAGAAGCT
NM_001007098.2      AGCTCGTTTGAAGAAAAAAGCATTATTAAAATGGTTGGCTTTGATATGAGTAAAGAAGCT
NM_001193600.1      AGCTCGTTTGAAGAAAAAAGCATTATTAAAATGGTTGGCTTTGATATGAGTAAAGAAGCT
                    ************************************************************

HsCD00288637        GCAAGAAAATGCTATGAGAAATCTGGCCTGACACCAAATGATATTGACGTAATAGAACTT
NM_001193617.1      GCAAGAAAATGCTATGAGAAATCTGGCCTGACACCAAATGATATTGACGTAATAGAACTT
NM_001007098.2      GCAAGAAAATGCTATGAGAAATCTGGCCTGACACCAAATGATATTGACGTAATAGAACTT
NM_001193600.1      GCAAGAAAATGCTATGAGAAATCTGGCCTGACACCAAATGATATTGACGTAATAGAACTT
                    ************************************************************

HsCD00288637        CACGATTGCTTTTCTACCAACGAACTCCTTACTTATGAAGCACTGGGACTCTGTCCAGAA
NM_001193617.1      CACGATTGCTTTTCTACCAACGAACTCCTTACTTATGAAGCACTGGGACTCTGTCCAGAA
NM_001007098.2      CACGATTGCTTTTCTACCAACGAACTCCTTACTTATGAAGCACTGGGACTCTGTCCAGAA
NM_001193600.1      CACGATTGCTTTTCTACCAACGAACTCCTTACTTATGAAGCACTGGGACTCTGTCCAGAA
                    ************************************************************

HsCD00288637        GGACAAGGTGCAACGCTGGTTGATAGAGGAGATAATACATATGGAGGAAAGTGGGTCATA
NM_001193617.1      GGACAAGGTGCAACGCTGGTTGATAGAGGAGATAATACATATGGAGGAAAGTGGGTCATA
NM_001007098.2      GGACAAGGTGCAACGCTGGTTGATAGAGGAGATAATACATATGGAGGAAAGTGGGTCATA
NM_001193600.1      GGACAAGGTGCAACGCTGGTTGATAGAGGAGATAATACATATGGAGGAAAGTGGGTCATA
                    ************************************************************

HsCD00288637        AATCCTAGTGGTGGACTGATTTCAAAGGGACACCCACTAGGCGCTACAGGAGGACATTCC
NM_001193617.1      AATCCTAGTGGTGGACTGATTTCAAAGGGACACCCACTAGGCGCTACAGGTCTTGCTCAG
NM_001007098.2      AATCCTAGTGGTGGACTGATTTCAAAGGGACACCCACTAGGCGCTACAGGAGGACATTCC
NM_001193600.1      AATCCTAGTGGTGGACTGATTTCAAAGGGACACCCACTAGGCGCTACAGGTCTTGCTCAG
                    **************************************************:  : .* . 

HsCD00288637        TGCTCTTGC---------------------------------------------------
NM_001193617.1      TGTGCAGAACTCTGCTGGCAGCTGAGAGGGGAAGCCGGAAAGAGGCAAGTTCCTGGTGCA
NM_001007098.2      TGCTCTTGA---------------------------------------------------
NM_001193600.1      TGTGCAGAACTCTGCTGGCAGCTGAGAGGGGAAGCCGGAAAGAGGCAAGTTCCTGGTGCA
                    **  *: ..                                                   

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      AAGGTGGCTCTGCAGCATAATTTAGGCATTGGAGGAGCTGTGGTTGTAACACTCTACAAG
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      AAGGTGGCTCTGCAGCATAATTTAGGCATTGGAGGAGCTGTGGTTGTAACACTCTACAAG
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      ATGGGTTTTCCGGAAGCCGCCAGTTCTTTTAGAACTCATCAAATTGAAGCTGTTCCAACC
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      ATGGGTTTTCCGGAAGCCGCCAGTTCTTTTAGAACTCATCAAATTGAAGCTGTTCCAACC
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      AGCTCTGCAAGTGATGGATTTAAGGCAAATCTTGTTTTTAAGGAGATTGAGAAGAAACTT
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      AGCTCTGCAAGTGATGGATTTAAGGCAAATCTTGTTTTTAAGGAGATTGAGAAGAAACTT
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      GAAGAGGAAGGGGAACAGTTTGTGAAGAAAATCGGTGGTATTTTTGCCTTCAAGGTGAAA
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      GAAGAGGAAGGGGAACAGTTTGTGAAGAAAATCGGTGGTATTTTTGCCTTCAAGGTGAAA
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      GATGGCCCTGGGGGTAAAGAGGCCACCTGGGTGGTGGATGTGAAGAATGGCAAAGGATCA
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      GATGGCCCTGGGGGTAAAGAGGCCACCTGGGTGGTGGATGTGAAGAATGGCAAAGGATCA
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      GTGCTTCCTAACTCAGATAAGAAGGCTGACTGCACAATCACAATGGCTGACTCAGACTTC
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      GTGCTTCCTAACTCAGATAAGAAGGCTGACTGCACAATCACAATGGCTGACTCAGACTTC
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      CTGGCTTTAATGACTGGTAAAATGAATCCTCAGTCGGCCTTCTTTCAAGGCAAATTGAAA
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      CTGGCTTTAATGACTGGTAAAATGAATCCTCAGTCGGCCTTCTTTCAAGGCAAATTGAAA
                                                                                

HsCD00288637        ------------------------------------------------------------
NM_001193617.1      ATCACTGGCAACATGGGTCTCGCTATGAAGTTACAAAATCTTCAGCTTCAGCCAGGCAAC
NM_001007098.2      ------------------------------------------------------------
NM_001193600.1      ATCACTGGCAACATGGGTCTCGCTATGAAGTTACAAAATCTTCAGCTTCAGCCAGGCAAC
                                                                                

HsCD00288637        ------------
NM_001193617.1      GCTAAGCTCTGA
NM_001007098.2      ------------
NM_001193600.1      GCTAAGCTCTGA
                                

Pathways

Reactome : Beta-oxidation of pristanoyl-CoA
Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Peroxisomal lipid metabolism
Reactome : Synthesis of bile acids and bile salts
Reactome : Synthesis of bile acids and bile salts via 7alpha-hydroxycholesterol
Reactome : alpha-linolenic (omega3) and linoleic (omega6) acid metabolism
Reactome : alpha-linolenic acid (ALA) metabolism
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Mitochondrial LC-Fatty Acid Beta-Oxidation
WikiPathway : Peroxisomal beta-oxidation of tetracosanoyl-CoA

Protein

UniProt : F2Z3J1
UniProt : P22307
UniProt : Q59HG9
UniProt : B4DHP6
UniProt : B4DGJ9
UniProt : E1B6W5
UniProt : Q6NXF4
UniProt : B2R761
UniProt : A6NM69
UniProt : C9JC79
HPRD : 01700

Clone

Cloning Information : 471874
HIP Master Clone ID : 394792
Original Clone ID : 38778

Organism


TAX_ID : 9606
Species Specific ID: 6342

Genome

Chromosome : 1
Map Location : 1p32
Ensembl : ENSG00000116171