DNASU Plasmid Repository • 480.965.5697 | Email

APIP (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  APIP
Gene Name:  APAF1 interacting protein
Sequence             
Original Clone ID: 56017
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00288692

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 729nts         Open reading frame : 1 to 729
Reference Sequence Alignment

ATGTCTGGCTGTGATGCTTGGGAGGGAGACTGTTGTTCCCGGAGATGCGGCGCGCAGGAC
AAGGAGCATCCAAGATACCTGATCCCAGAACTTTGCAAACAGTTTTACCATTTAGGCTGG
GTCACTGGGACTGGAGGAGGAATTAGCTTGAAGCATGGCGATGAAATCTACATTGCTCCT
TCAGGAGTGCAAAAGGAACGAATTCAGCCTGAAGACATGTTTGTTTATGATATAAATGAA
AAGGACATAAGTGGACCTTCGCCATCGAAGAAGCTAAAAAAAAGCCAGTGTACTCCTCTT
TTCATGAATGCTTACACAATGAGAGGAGCAGGTGCAGTGATTCATACCCACTCTAAAGCT
GCTGTGATGGCCACCCTTCTCTTTCCAGGACGGGAGTTTAAAATTACACATCAAGAGATG
ATAAAAGGAATAAAGAAATGTACTTCCGGAGGGTATTATAGATATGATGATATGTTAGTG
GTACCCATTATTGAGAATACACCTGAGGAGAAAGACCTCAAAGATAGAATGGCTCATGCA
ATGAATGAATACCCAGACTCCTGTGCAGTACTGGTCAGACGTCATGGAGTATATGTGTGG
GGGGAAACATGGGAGAAGGCCAAAACCATGTGTGAGTGTTATGACTATTTATTTGATATT
GCCGTATCAATGAAGAAAGTAGGACTTGATCCTTCACAGCTCCCAGTTGGAGAAAATGCA
ATTGTCTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 765
Start on reference sequence 37
Mutations:
None
Discrepancy:
g719c,G240A
                                

5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : APIP
Symbol Nomenclature : APIP
SYNONYM : APIP2; CGI29; MMRP19; hAPIP
Designation : APAF1-interacting protein|MTRu-1-P dehydratase|methylthioribulose-1-phosphate dehydratase|probable methylthioribulose-1-phosphate dehydratase
Full Nomenclature : APAF1 interacting protein
GENEID : 51074
Locus Tag : CGI-29
HGNC : 17581
MIM : 612491
Vega : OTTHUMG00000166455
Target GenBank: BC017594.2

 

Reference Sequence Alignment

  

HsCD00288692      ATGTCTGGCTGTGATGCTTGGGAGGGAGACTGTTGTTCCCGGAGATGCGGCGCGCAGGAC
NM_015957.3       ATGTCTGGCTGTGATGCTCGGGAGGGAGACTGTTGTTCCCGGAGATGCGGCGCGCAGGAC
                  ****************** *****************************************

HsCD00288692      AAGGAGCATCCAAGATACCTGATCCCAGAACTTTGCAAACAGTTTTACCATTTAGGCTGG
NM_015957.3       AAGGAGCATCCAAGATACCTGATCCCAGAACTTTGCAAACAGTTTTACCATTTAGGCTGG
                  ************************************************************

HsCD00288692      GTCACTGGGACTGGAGGAGGAATTAGCTTGAAGCATGGCGATGAAATCTACATTGCTCCT
NM_015957.3       GTCACTGGGACTGGAGGAGGAATTAGCTTGAAGCATGGCGATGAAATCTACATTGCTCCT
                  ************************************************************

HsCD00288692      TCAGGAGTGCAAAAGGAACGAATTCAGCCTGAAGACATGTTTGTTTATGATATAAATGAA
NM_015957.3       TCAGGAGTGCAAAAGGAACGAATTCAGCCTGAAGACATGTTTGTTTGTGATATAAATGAA
                  **********************************************.*************

HsCD00288692      AAGGACATAAGTGGACCTTCGCCATCGAAGAAGCTAAAAAAAAGCCAGTGTACTCCTCTT
NM_015957.3       AAGGACATAAGTGGACCTTCGCCATCGAAGAAGCTAAAAAAAAGCCAGTGTACTCCTCTT
                  ************************************************************

HsCD00288692      TTCATGAATGCTTACACAATGAGAGGAGCAGGTGCAGTGATTCATACCCACTCTAAAGCT
NM_015957.3       TTCATGAATGCTTACACAATGAGAGGAGCAGGTGCAGTGATTCATACCCACTCTAAAGCT
                  ************************************************************

HsCD00288692      GCTGTGATGGCCACCCTTCTCTTTCCAGGACGGGAGTTTAAAATTACACATCAAGAGATG
NM_015957.3       GCTGTGATGGCCACACTTCTCTTTCCAGGACGGGAGTTTAAAATTACACATCAAGAGATG
                  **************.*********************************************

HsCD00288692      ATAAAAGGAATAAAGAAATGTACTTCCGGAGGGTATTATAGATATGATGATATGTTAGTG
NM_015957.3       ATAAAAGGAATAAAGAAATGTACTTCCGGAGGGTATTATAGATATGATGATATGTTAGTG
                  ************************************************************

HsCD00288692      GTACCCATTATTGAGAATACACCTGAGGAGAAAGACCTCAAAGATAGAATGGCTCATGCA
NM_015957.3       GTACCCATTATTGAGAATACACCTGAGGAGAAAGACCTCAAAGATAGAATGGCTCATGCA
                  ************************************************************

HsCD00288692      ATGAATGAATACCCAGACTCCTGTGCAGTACTGGTCAGACGTCATGGAGTATATGTGTGG
NM_015957.3       ATGAATGAATACCCAGACTCCTGTGCAGTACTGGTCAGACGTCATGGAGTATATGTGTGG
                  ************************************************************

HsCD00288692      GGGGAAACATGGGAGAAGGCCAAAACCATGTGTGAGTGTTATGACTATTTATTTGATATT
NM_015957.3       GGGGAAACATGGGAGAAGGCCAAAACCATGTGTGAGTGTTATGACTATTTATTTGATATT
                  ************************************************************

HsCD00288692      GCCGTATCAATGAAGAAAGTAGGACTTGATCCTTCACAGCTCCCAGTTGGAGAAAATGCA
NM_015957.3       GCCGTATCAATGAAGAAAGTAGGACTTGATCCTTCACAGCTCCCAGTTGGAGAAAATGGA
                  ********************************************************** *

HsCD00288692      ATTGTCTAC
NM_015957.3       ATTGTCTAA
                  ********.

Pathways

Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of polyamines
Reactome : Methionine salvage pathway
Reactome : Sulfur amino acid metabolism

Clone

Cloning Information : 471929
HIP Master Clone ID : 394847
Original Clone ID : 56017

Organism


TAX_ID : 9606
Species Specific ID: 51074

Genome

Chromosome : 11
Map Location : 11p13
Ensembl : ENSG00000149089

Reagents

Labome : APIP-antibody