DNASU Plasmid Repository • 480.965.5697 | Email

CALCA (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CALCA
Gene Name:  calcitonin-related polypeptide alpha
Sequence             
Original Clone ID: 43590
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288981

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 426nts         Open reading frame : 1 to 426
Reference Sequence Alignment

ATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTGGTCCTGTTGCAGGCA
GGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGCCCAGCAGACCCGGCC
ACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTGCAGGACTATGTGCAG
ATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCCAGCCTGGACAGCCCC
AGATCTAAGCGGTGCGGTAATCTGAGTACTTGCATGCTGGGCACATACACGCAGGACTTC
AACAAGTTTCACACGTTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGAAAGAAAAGG
GATATGTCCAGCGACTTGGAGAGAGACCATCGCCCTCATGTTAGCATGCCCCAGAATGCC
AACTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 477
Start on reference sequence 52
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CALCA
Symbol Nomenclature : CALCA
SYNONYM : CALC1; CGRP; CGRP-I; CGRP1; CT; KC
Designation : alpha-type CGRP|calcitonin|calcitonin 1|calcitonin gene-related peptide I|calcitonin/calcitonin-related polypeptide, alpha|katacalcin
Full Nomenclature : calcitonin-related polypeptide alpha
GENEID : 796
HGNC : 1437
MIM : 114130
Vega : OTTHUMG00000159731
Target GenBank: BC069760.1

 

Reference Sequence Alignment

  

HsCD00288981        ATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTGGTCCTGTTGCAGGCA
NM_001741.2         ATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTGGTCCTGTTGCAGGCA
NM_001033952.2      ATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTGGTCCTGTTGCAGGCA
                    ************************************************************

HsCD00288981        GGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGCCCAGCAGACCCGGCC
NM_001741.2         GGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGCCCAGCAGACCCGGCC
NM_001033952.2      GGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGCCCAGCAGACCCGGCC
                    ************************************************************

HsCD00288981        ACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTGCAGGACTATGTGCAG
NM_001741.2         ACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTGCAGGACTATGTGCAG
NM_001033952.2      ACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTGCAGGACTATGTGCAG
                    ************************************************************

HsCD00288981        ATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCCAGCCTGGACAGCCCC
NM_001741.2         ATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCCAGCCTGGACAGCCCC
NM_001033952.2      ATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCCAGCCTGGACAGCCCC
                    ************************************************************

HsCD00288981        AGATCTAAGCGGTGCGGTAATCTGAGTACTTGCATGCTGGGCACATACACGCAGGACTTC
NM_001741.2         AGATCTAAGCGGTGCGGTAATCTGAGTACTTGCATGCTGGGCACATACACGCAGGACTTC
NM_001033952.2      AGATCTAAGCGGTGCGGTAATCTGAGTACTTGCATGCTGGGCACATACACGCAGGACTTC
                    ************************************************************

HsCD00288981        AACAAGTTTCACACGTTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGAAAGAAAAGG
NM_001741.2         AACAAGTTTCACACGTTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGAAAGAAAAGG
NM_001033952.2      AACAAGTTTCACACGTTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGAAAGAAAAGG
                    ************************************************************

HsCD00288981        GATATGTCCAGCGACTTGGAGAGAGACCATCGCCCTCATGTTAGCATGCCCCAGAATGCC
NM_001741.2         GATATGTCCAGCGACTTGGAGAGAGACCATCGCCCTCATGTTAGCATGCCCCAGAATGCC
NM_001033952.2      GATATGTCCAGCGACTTGGAGAGAGACCATCGCCCTCATGTTAGCATGCCCCAGAATGCC
                    ************************************************************

HsCD00288981        AACTAC
NM_001741.2         AACTAA
NM_001033952.2      AACTAA
                    *****.

Pathways

Reactome : Amyloids
Reactome : Calcitonin-like ligand receptors
Reactome : Class B/2 (Secretin family receptors)
Reactome : Disease
Reactome : G alpha (s) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : CALCITONIN : calcitonin
UniProt : P06881
UniProt : P01258
HPRD : 00238

Clone

Cloning Information : 472218
HIP Master Clone ID : 395136
Original Clone ID : 43590

Organism


TAX_ID : 9606
Species Specific ID: 796

Genome

Chromosome : 11
Map Location : 11p15.2
Ensembl : ENSG00000110680

Reagents

Labome : calcitonin-antibody