DNASU Plasmid Repository • 480.965.5697 | Email

HSPA1A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HSPA1A
Gene Name:  heat shock 70kDa protein 1A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH116883.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002890

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1926nts         Open reading frame : 1 to 1926
Reference Sequence Alignment

ATGGCCAAAGCCGCGGCGATCGGCATCGACCTGGGCACCACCTACTCCTGCGTGGGGGTG
TTCCAACACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACCCCCAGC
TACGTGGCCTTCACGGACACCGAGCGGCTCATCGGGGATGCGGCCAAGAACCAGGTGGCG
CTGAACCCGCAGAACACCGTGTTTGACGCGAAGCGGCTGATCGGCCGCAAGTTCGGCGAC
CCGGTGGTGCAGTCGGACATGAAGCACTGGCCTTTCCAGGTGATCAACGACGGAGACAAG
CCCAAGGTGCAGGTGAGCTACAAGGGGGAGACCAAGGCATTCTACCCCGAGGAGATCTCG
TCCATGGTGCTGACCAAGATGAAGGAGATCGCCGAGGCGTACCTGGGCTACCCGGTGACC
AACGCGGTGATCACCGTGCCGGCCTACTTCAACGACTCGCAGCGCCAGGCCACCAAGGAT
GCGGGTGTGATCGCGGGGCTCAACGTGCTGCGGATCATCAACGAGCCCACGGCCGCCGCC
ATCGCCTACGGCCTGGACAGAACGGGCAAGGGGGAGCGCAACGTGCTCATCTTTGACCTG
GGCGGGGGCACCTTCGACGTGTCCATCCTGACGATCGACGACGGCATCTTCGAGGTGAAG
GCCACGGCCGGGGACACCCACCTGGGTGGGGAGGACTTTGACAACAGGCTGGTGAACCAC
TTCGTGGAGGAGTTCAAGAGAAAACACAAGAAGGACATCAGCCAGAACAAGCGAGCCGTG
AGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACCCAGGCC
AGCCTGGAGATCGACTCCCTGTTTGAGGGCATCGACTTCTACACGTCCATCACCAGGGCG
AGGTTCGAGGAGCTGTGCTCCGACCTGTTCCGAAGCACCCTGGAGCCCGTGGAGAAGGCT
CTGCGCGACGCCAAGCTGGACAAGGCCCAGATTCACGACCTGGTCCTGGTCGGGGGCTCC
ACCCGCATCCCCAAGGTGCAGAAGCTGCTGCAGGACTTCTTCAACGGGCGCGACCTGAAC
AAGAGCATCAACCCCGACGAGGCTGTGGCCTACGGGGCGGCGGTGCAGGCGGCCATCCTG
ATGGGGGACAAGTCCGAGAACGTGCAGGACCTGCTGCTGCTGGACGTGGCTCCCCTGTCG
CTGGGGCTGGAGACGGCCGGAGGCGTGATGACTGCCCTGATCAAGCGCAACTCCACCATC
CCCACCAAGCAGACGCAGATCTTCACCACCTACTCCGACAACCAACCCGGGGTGCTGATC
CAGGTGTACGAGGGCGAGAGGGCCATGACGAAAGACAACAATCTGTTGGGGCGCTTCGAG
CTGAGCGGCATCCCTCCGGCCCCCAGGGGCGTGCCCCAGATCGAGGTGACCTTCGACATC
GATGCCAACGGCATCCTGAACGTCACGGCCACGGACAAGAGCACCGGCAAGGCCAACAAG
ATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGATCGAGCGCATGGTGCAG
GAGGCGGAGAAGTACAAAGCGGAGGACGAGGTGCAGCGCGAGAGGGTGTCAGCCAAGAAC
GCCCTGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGC
AAGATCAGCGAGGCGGACAAGAAGAAGGTTCTGGACAAGTGTCAAGAGGTCATCTCGTGG
CTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAG
CAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGG
GGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTG
GATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2112
Start on reference sequence 187
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HSPA1A
Symbol Nomenclature : HSPA1A
SYNONYM : HEL-S-103; HSP70-1; HSP70-1A; HSP70I; HSP72; HSPA1
Designation : HSP70-1/HSP70-2|HSP70.1/HSP70.2|dnaK-type molecular chaperone HSP70-1|epididymis secretory protein Li 103|heat shock 70 kDa protein 1/2|heat shock 70 kDa protein 1A/1B|heat shock 70kD protein 1A|heat shock-induced protein
Full Nomenclature : heat shock 70kDa protein 1A
GENEID : 3303
Locus Tag : DAQB-147D11.1
GI : 61372080
GenBank Accession : AY891855
HGNC : 5232
MIM : 140550
Vega : OTTHUMG00000031201
Target GenBank: BC002453

 

Reference Sequence Alignment

  

HsCD00002890        ------ATGGCCAAAGCCGCGGCGATCGGCATCGACCTGGGCACCACCTACTCCTGCGTG
XM_005275402.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005274861.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005274973.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005274974.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
NM_005527.3         ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005274862.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005272816.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
NM_005346.4         ------ATGGCCAAAGCCGCGGCGATCGGCATCGACCTGGGCACCACCTACTCCTGCGTG
XM_005249071.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005272817.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
NM_005345.5         ------ATGGCCAAAGCCGCGGCGATCGGCATCGACCTGGGCACCACCTACTCCTGCGTG
XM_005249073.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
XM_005275401.1      ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
                          *  *****.* ..  ** **.***************************** ***

HsCD00002890        GGGGTGTTCCAACACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005275402.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005274861.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005274973.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005274974.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
NM_005527.3         GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005274862.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005272816.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
NM_005346.4         GGGGTGTTCCAACACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005249071.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005272817.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
NM_005345.5         GGGGTGTTCCAACACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005249073.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
XM_005275401.1      GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
                    ***********.************************************************

HsCD00002890        CCCAGCTACGTGGCCTTCACGGACACCGAGCGGCTCATCGGGGATGCGGCCAAGAACCAG
XM_005275402.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005274861.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005274973.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005274974.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
NM_005527.3         CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005274862.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005272816.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
NM_005346.4         CCCAGCTACGTGGCCTTCACGGACACCGAGCGGCTCATCGGGGATGCGGCCAAGAACCAG
XM_005249071.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005272817.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
NM_005345.5         CCCAGCTACGTGGCCTTCACGGACACCGAGCGGCTCATCGGGGATGCGGCCAAGAACCAG
XM_005249073.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
XM_005275401.1      CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
                    ********************.***************** *********************

HsCD00002890        GTGGCGCTGAACCCGCAGAACACCGTGTTTGACGCGAAGCGGCTGATCGGCCGCAAGTTC
XM_005275402.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005274861.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005274973.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005274974.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
NM_005527.3         GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005274862.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005272816.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
NM_005346.4         GTGGCGCTGAACCCGCAGAACACCGTGTTTGACGCGAAGCGGCTGATCGGCCGCAAGTTC
XM_005249071.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005272817.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
NM_005345.5         GTGGCGCTGAACCCGCAGAACACCGTGTTTGACGCGAAGCGGCTGATTGGCCGCAAGTTC
XM_005249073.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
XM_005275401.1      GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
                    **.**..**** ** ******** ** ***** ** **.** ***** ***.* **.** 

HsCD00002890        GGCGACCCGGTGGTGCAGTCGGACATGAAGCACTGGCCTTTCCAGGTGATCAACGACGGA
XM_005275402.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005274861.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005274973.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005274974.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
NM_005527.3         AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005274862.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005272816.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
NM_005346.4         GGCGACCCGGTGGTGCAGTCGGACATGAAGCACTGGCCTTTCCAGGTGATCAACGACGGA
XM_005249071.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005272817.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
NM_005345.5         GGCGACCCGGTGGTGCAGTCGGACATGAAGCACTGGCCTTTCCAGGTGATCAACGACGGA
XM_005249073.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
XM_005275401.1      AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
                    .. ** ** ** **.**. *.** *****.*: ******** **.***** ** **.***

HsCD00002890        GACAAGCCCAAGGTGCAGGTGAGCTACAAGGGGGAGACCAAGGCATTCTACCCCGAGGAG
XM_005275402.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005274861.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005274973.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005274974.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
NM_005527.3         GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005274862.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005272816.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
NM_005346.4         GACAAGCCCAAGGTGCAGGTGAGCTACAAGGGGGAGACCAAGGCATTCTACCCCGAGGAG
XM_005249071.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005272817.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
NM_005345.5         GACAAGCCCAAGGTGCAGGTGAGCTACAAGGGGGAGACCAAGGCATTCTACCCCGAGGAG
XM_005249073.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
XM_005275401.1      GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
                    *.*********.** *: ***: ******.*******. **.**:******** *****.

HsCD00002890        ATCTCGTCCATGGTGCTGACCAAGATGAAGGAGATCGCCGAGGCGTACCTGGGCTACCCG
XM_005275402.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005274861.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005274973.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005274974.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
NM_005527.3         ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005274862.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005272816.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
NM_005346.4         ATCTCGTCCATGGTGCTGACCAAGATGAAGGAGATCGCCGAGGCGTACCTGGGCTACCCG
XM_005249071.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005272817.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
NM_005345.5         ATCTCGTCCATGGTGCTGACCAAGATGAAGGAGATCGCCGAGGCGTACCTGGGCTACCCG
XM_005249073.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
XM_005275401.1      ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
                    ***** ** *****. **** ***:*********  ** ***** *:  ***** **** 

HsCD00002890        GTGACCAACGCGGTGATCACCGTGCCGGCCTACTTCAACGACTCGCAGCGCCAGGCCACC
XM_005275402.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005274861.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005274973.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005274974.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
NM_005527.3         GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005274862.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005272816.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
NM_005346.4         GTGACCAACGCGGTGATCACCGTGCCGGCCTACTTCAACGACTCGCAGCGCCAGGCCACC
XM_005249071.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005272817.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
NM_005345.5         GTGACCAACGCGGTGATCACCGTGCCGGCCTACTTCAACGACTCGCAGCGCCAGGCCACC
XM_005249073.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
XM_005275401.1      GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
                    ** ***** **.***** ********.***** ***** ***** **.** ***** ** 

HsCD00002890        AAGGATGCGGGTGTGATCGCGGGGCTCAACGTGCTGCGGATCATCAACGAGCCCACGGCC
XM_005275402.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005274861.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005274973.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005274974.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
NM_005527.3         AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005274862.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005272816.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
NM_005346.4         AAGGATGCGGGTGTGATCGCGGGGCTCAACGTGCTGCGGATCATCAACGAGCCCACGGCC
XM_005249071.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005272817.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
NM_005345.5         AAGGATGCGGGTGTGATCGCGGGGCTCAACGTGCTGCGGATCATCAACGAGCCCACGGCC
XM_005249073.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
XM_005275401.1      AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
                    ********.******** ** **.** ** *****..*.******** *********** 

HsCD00002890        GCCGCCATCGCCTACGGCCTGGACAGAACGGGCAAGGGGGAGCGCAACGTGCTCATCTTT
XM_005275402.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005274861.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005274973.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005274974.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
NM_005527.3         GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005274862.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005272816.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
NM_005346.4         GCCGCCATCGCCTACGGCCTGGACAGAACGGGCAAGGGGGAGCGCAACGTGCTCATCTTT
XM_005249071.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005272817.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
NM_005345.5         GCCGCCATCGCCTACGGCCTGGACAGAACGGGCAAGGGGGAGCGCAACGTGCTCATCTTT
XM_005249073.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
XM_005275401.1      GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
                    ** ***** ***** **  *.** *.*. .** .*.**.**.**..* ** ** ** ***

HsCD00002890        GACCTGGGCGGGGGCACCTTCGACGTGTCCATCCTGACGATCGACGACGGCATCTTCGAG
XM_005275402.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005274861.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005274973.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005274974.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
NM_005527.3         GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005274862.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005272816.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
NM_005346.4         GACCTGGGCGGGGGCACCTTCGACGTGTCCATCCTGACGATCGACGACGGCATCTTCGAG
XM_005249071.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005272817.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
NM_005345.5         GACCTGGGCGGGGGCACCTTCGACGTGTCCATCCTGACGATCGACGACGGCATCTTCGAG
XM_005249073.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
XM_005275401.1      GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
                    ** ***** **.*****.** ** *****.** ***** **.** ** ** ** ** ***

HsCD00002890        GTGAAGGCCACGGCCGGGGACACCCACCTGGGTGGGGAGGACTTTGACAACAGGCTGGTG
XM_005275402.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005274861.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005274973.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005274974.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
NM_005527.3         GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005274862.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005272816.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
NM_005346.4         GTGAAGGCCACGGCCGGGGACACCCACCTGGGTGGGGAGGACTTTGACAACAGGCTGGTG
XM_005249071.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005272817.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
NM_005345.5         GTGAAGGCCACGGCCGGGGACACCCACCTGGGTGGGGAGGACTTTGACAACAGGCTGGTG
XM_005249073.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
XM_005275401.1      GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
                    **.******** ** ******** ******************************** ***

HsCD00002890        AACCACTTCGTGGAGGAGTTCAAGAGAAAACACAAGAAGGACATCAGCCAGAACAAGCGA
XM_005275402.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005274861.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005274973.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005274974.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
NM_005527.3         AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005274862.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005272816.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
NM_005346.4         AACCACTTCGTGGAGGAGTTCAAGAGAAAACACAAGAAGGACATCAGCCAGAACAAGCGA
XM_005249071.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005272817.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
NM_005345.5         AACCACTTCGTGGAGGAGTTCAAGAGAAAACACAAGAAGGACATCAGCCAGAACAAGCGA
XM_005249073.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
XM_005275401.1      AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
                    *.************************.********.************************

HsCD00002890        GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005275402.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005274861.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005274973.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005274974.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
NM_005527.3         GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005274862.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005272816.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
NM_005346.4         GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005249071.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005272817.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
NM_005345.5         GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005249073.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
XM_005275401.1      GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
                    ************************************************************

HsCD00002890        CAGGCCAGCCTGGAGATCGACTCCCTGTTTGAGGGCATCGACTTCTACACGTCCATCACC
XM_005275402.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005274861.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005274973.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005274974.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
NM_005527.3         CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005274862.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005272816.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
NM_005346.4         CAGGCCAGCCTGGAGATCGACTCCCTGTTTGAGGGCATCGACTTCTACACGTCCATCACC
XM_005249071.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005272817.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
NM_005345.5         CAGGCCAGCCTGGAGATCGACTCCCTGTTTGAGGGCATCGACTTCTACACGTCCATCACC
XM_005249073.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
XM_005275401.1      CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
                    *******.***.**.** ** **.** *:***.***** ******** **.*********

HsCD00002890        AGGGCGAGGTTCGAGGAGCTGTGCTCCGACCTGTTCCGAAGCACCCTGGAGCCCGTGGAG
XM_005275402.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005274861.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005274973.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005274974.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
NM_005527.3         AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005274862.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005272816.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
NM_005346.4         AGGGCGAGGTTCGAGGAGCTGTGCTCCGACCTGTTCCGAAGCACCCTGGAGCCCGTGGAG
XM_005249071.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005272817.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
NM_005345.5         AGGGCGAGGTTCGAGGAGCTGTGCTCCGACCTGTTCCGAAGCACCCTGGAGCCCGTGGAG
XM_005249073.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
XM_005275401.1      AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
                    **.** .*.** **.*** ****  *.******** .*..* *********** **.**.

HsCD00002890        AAGGCTCTGCGCGACGCCAAGCTGGACAAGGCCCAGATTCACGACCTGGTCCTGGTCGGG
XM_005275402.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005274861.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005274973.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005274974.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
NM_005527.3         AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005274862.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005272816.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
NM_005346.4         AAGGCTCTGCGCGACGCCAAGCTGGACAAGGCCCAGATTCACGACCTGGTCCTGGTCGGG
XM_005249071.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005272817.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
NM_005345.5         AAGGCTCTGCGCGACGCCAAGCTGGACAAGGCCCAGATTCACGACCTGGTCCTGGTCGGG
XM_005249073.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
XM_005275401.1      AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
                    **.** ** ** ** ******.**** ***** .*.** ** ***.* **  *.**.***

HsCD00002890        GGCTCCACCCGCATCCCCAAGGTGCAGAAGCTGCTGCAGGACTTCTTCAACGGGCGCGAC
XM_005275402.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005274861.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005274973.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005274974.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
NM_005527.3         GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005274862.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005272816.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
NM_005346.4         GGCTCCACCCGCATCCCCAAGGTGCAGAAGCTGCTGCAGGACTTCTTCAACGGGCGCGAC
XM_005249071.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005272817.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
NM_005345.5         GGCTCCACCCGCATCCCCAAGGTGCAGAAGCTGCTGCAGGACTTCTTCAACGGGCGCGAC
XM_005249073.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
XM_005275401.1      GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
                    ***************************..****** *******:****** **.** ** 

HsCD00002890        CTGAACAAGAGCATCAACCCCGACGAGGCTGTGGCCTACGGGGCGGCGGTGCAGGCGGCC
XM_005275402.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005274861.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005274973.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005274974.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
NM_005527.3         CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005274862.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005272816.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
NM_005346.4         CTGAACAAGAGCATCAACCCCGACGAGGCTGTGGCCTACGGGGCGGCGGTGCAGGCGGCC
XM_005249071.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005272817.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
NM_005345.5         CTGAACAAGAGCATCAACCCCGACGAGGCTGTGGCCTACGGGGCGGCGGTGCAGGCGGCC
XM_005249073.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
XM_005275401.1      CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
                    ** ***************** ** ***** **.**.** ***** *****.**.**.***

HsCD00002890        ATCCTGATGGGGGACAAGTCCGAGAACGTGCAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005275402.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005274861.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005274973.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005274974.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
NM_005527.3         ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005274862.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005272816.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
NM_005346.4         ATCCTGATGGGGGACAAGTCCGAGAACGTGCAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005249071.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005272817.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
NM_005345.5         ATCCTGATGGGGGACAAGTCCGAGAACGTGCAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005249073.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
XM_005275401.1      ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
                    ******************** ***** **.******************************

HsCD00002890        CTGTCGCTGGGGCTGGAGACGGCCGGAGGCGTGATGACTGCCCTGATCAAGCGCAACTCC
XM_005275402.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005274861.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005274973.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005274974.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
NM_005527.3         CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005274862.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005272816.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
NM_005346.4         CTGTCGCTGGGGCTGGAGACGGCCGGAGGCGTGATGACTGCCCTGATCAAGCGCAACTCC
XM_005249071.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005272817.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
NM_005345.5         CTGTCGCTGGGGCTGGAGACGGCCGGAGGCGTGATGACTGCCCTGATCAAGCGCAACTCC
XM_005249073.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
XM_005275401.1      CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
                    ***** ***************** **.********************.************

HsCD00002890        ACCATCCCCACCAAGCAGACGCAGATCTTCACCACCTACTCCGACAACCAACCCGGGGTG
XM_005275402.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005274861.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005274973.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005274974.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
NM_005527.3         ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005274862.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005272816.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
NM_005346.4         ACCATCCCCACCAAGCAGACGCAGATCTTCACCACCTACTCCGACAACCAACCCGGGGTG
XM_005249071.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005272817.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
NM_005345.5         ACCATCCCCACCAAGCAGACGCAGATCTTCACCACCTACTCCGACAACCAACCCGGGGTG
XM_005249073.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
XM_005275401.1      ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
                    ********************.***** ************** ******************

HsCD00002890        CTGATCCAGGTGTACGAGGGCGAGAGGGCCATGACGAAAGACAACAATCTGTTGGGGCGC
XM_005275402.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005274861.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005274973.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005274974.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
NM_005527.3         CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005274862.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005272816.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
NM_005346.4         CTGATCCAGGTGTACGAGGGCGAGAGGGCCATGACGAAAGACAACAATCTGTTGGGGCGC
XM_005249071.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005272817.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
NM_005345.5         CTGATCCAGGTGTACGAGGGCGAGAGGGCCATGACGAAAGACAACAATCTGTTGGGGCGC
XM_005249073.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
XM_005275401.1      CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
                    ************** ********************.**.******** *** ******* 

HsCD00002890        TTCGAGCTGAGCGGCATCCCTCCGGCCCCCAGGGGCGTGCCCCAGATCGAGGTGACCTTC
XM_005275402.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005274861.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005274973.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005274974.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
NM_005527.3         TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005274862.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005272816.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
NM_005346.4         TTCGAGCTGAGCGGCATCCCTCCGGCCCCCAGGGGCGTGCCCCAGATCGAGGTGACCTTC
XM_005249071.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005272817.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
NM_005345.5         TTCGAGCTGAGCGGCATCCCTCCGGCCCCCAGGGGCGTGCCCCAGATCGAGGTGACCTTC
XM_005249073.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
XM_005275401.1      TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
                    ** ** ****  **.********.**.********.** ** ************** ** 

HsCD00002890        GACATCGATGCCAACGGCATCCTGAACGTCACGGCCACGGACAAGAGCACCGGCAAGGCC
XM_005275402.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
XM_005274861.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
XM_005274973.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCACGGACAAGAGCACCGGCAAGGTG
XM_005274974.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCACGGACAAGAGCACCGGCAAGGTG
NM_005527.3         GACATTGATGCCAATGGTATTCTCAATGTCACAGCCACGGACAAGAGCACCGGCAAGGTG
XM_005274862.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
XM_005272816.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
NM_005346.4         GACATCGATGCCAACGGCATCCTGAACGTCACGGCCACGGACAAGAGCACCGGCAAGGCC
XM_005249071.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCACGGACAAGAGCACCGGCAAGGTG
XM_005272817.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
NM_005345.5         GACATCGATGCCAACGGCATCCTGAACGTCACGGCCACGGACAAGAGCACCGGCAAGGCC
XM_005249073.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCACGGACAAGAGCACCGGCAAGGTG
XM_005275401.1      GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
                    ***** ******** ** ** ** ** *****.**** ********************  

HsCD00002890        AACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGATCGAGCGCATG
XM_005275402.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005274861.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005274973.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005274974.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
NM_005527.3         AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005274862.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005272816.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
NM_005346.4         AACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGATCGAGCGCATG
XM_005249071.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005272817.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
NM_005345.5         AACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGATCGAGCGCATG
XM_005249073.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
XM_005275401.1      AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
                    ******************** ***************************** *********

HsCD00002890        GTGCAGGAGGCGGAGAAGTACAAAGCGGAGGACGAGGTGCAGCGCGAGAGGGTGTCAGCC
XM_005275402.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005274861.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005274973.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005274974.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
NM_005527.3         GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005274862.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005272816.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
NM_005346.4         GTGCAGGAGGCGGAGAAGTACAAAGCGGAGGACGAGGTGCAGCGCGAGAGGGTGTCAGCC
XM_005249071.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005272817.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
NM_005345.5         GTGCAGGAGGCGGAGAAGTACAAAGCGGAGGACGAGGTGCAGCGCGAGAGGGTGTCAGCC
XM_005249073.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
XM_005275401.1      GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
                    ** *:*** ** *****.** ***** **.** ***** ***.* ****...*  *:**.

HsCD00002890        AAGAACGCCCTGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTC
XM_005275402.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005274861.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005274973.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005274974.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
NM_005527.3         AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005274862.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005272816.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
NM_005346.4         AAGAACGCCCTGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTC
XM_005249071.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005272817.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
NM_005345.5         AAGAACGCCCTGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTC
XM_005249073.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
XM_005275401.1      AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
                    ***** *** *.**.***** ** ** *********** *  ***.. *****.**  * 

HsCD00002890        AAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTTCTGGACAAGTGTCAAGAGGTCATC
XM_005275402.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005274861.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005274973.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005274974.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
NM_005527.3         AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005274862.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005272816.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
NM_005346.4         AAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTTCTGGACAAGTGTCAAGAGGTCATC
XM_005249071.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005272817.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
NM_005345.5         AAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATC
XM_005249073.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
XM_005275401.1      AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
                    *********** ** *** * ** **.** **..*  **** **.** .*.*** **.* 

HsCD00002890        TCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAG
XM_005275402.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005274861.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005274973.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005274974.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
NM_005527.3         TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005274862.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005272816.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
NM_005346.4         TCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAG
XM_005249071.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005272817.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
NM_005345.5         TCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAG
XM_005249073.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
XM_005275401.1      TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
                    *********** * *** ... ****.*****.** ******** ** *****.*****.

HsCD00002890        CTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGG
XM_005275402.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005274861.1      TTGAAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005274973.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005274974.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
NM_005527.3         TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005274862.1      TTGAAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005272816.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
NM_005346.4         CTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGG
XM_005249071.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005272817.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
NM_005345.5         CTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGG
XM_005249073.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
XM_005275401.1      TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAG------GAGGATGCACT
                     **.*****.********** ******* ...*** *****.*      *:**:  *.  

HsCD00002890        CCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAG
XM_005275402.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005274861.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005274973.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005274974.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
NM_005527.3         GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005274862.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005272816.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
NM_005346.4         CCTGGCGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCTACCATTGAG
XM_005249071.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005272817.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
NM_005345.5         CCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAG
XM_005249073.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
XM_005275401.1      GGGCCTGCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAA
                          * ** ***..*: .* .*   .. ***.** ***  :******* **.*****.

HsCD00002890        GAGGTGGATTTG
XM_005275402.1      GAAGTAGATTAA
XM_005274861.1      GAAGTAGATTAA
XM_005274973.1      GAAGTAGATTAA
XM_005274974.1      GAAGTAGATTAA
NM_005527.3         GAAGTAGATTAA
XM_005274862.1      GAAGTAGATTAA
XM_005272816.1      GAAGTAGATTAA
NM_005346.4         GAGGTGGATTAG
XM_005249071.1      GAAGTAGATTAA
XM_005272817.1      GAAGTAGATTAA
NM_005345.5         GAGGTAGATTAG
XM_005249073.1      GAAGTAGATTAA
XM_005275401.1      GAAGTAGATTAA
                    **.**.****:.

Pathways

Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Attenuation phase
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Disease
Reactome : Export of Viral Ribonucleoproteins from Nucleus
Reactome : Gene Expression
Reactome : HSF1 activation
Reactome : HSF1-dependent transactivation
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Viral RNP Complexes in the Host Cell Nucleus
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : MAPK signaling pathway

Protein

UniProt : B3KTT5
UniProt : P08107
UniProt : A8K5I0
HPRD : 00774

Clone

Cloning Information : 116883
HIP Master Clone ID : 92729
Original Clone ID : FLH116883.01L

Organism


TAX_ID : 9606
Species Specific ID: 3303

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000204389

Reagents

Labome : Hsp70-antibody