DNASU Plasmid Repository • 480.965.5697 | Email

POLR1D (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR1D
Gene Name:  polymerase (RNA) I polypeptide D, 16kDa
Sequence             
Original Clone ID: 9548
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00289277

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 369nts         Open reading frame : 1 to 369
Reference Sequence Alignment

ATGGAAGAGGATCAGGAGCTGGAGAGGAAAGCAATAGAAGAACTGCTTAAGGAGGCAAAA
CGTGGGAAAACTAGAGCTGAAACAATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCT
AGCACCAATAAAAGATTTCTAATTAACACAATTAAAAACACATTGCCCTCTCATAAAGAG
CAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAGAGCCAGGCCCAGAAAGAA
GAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCTCGAGGTTCC
GCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAAC
CGGCGGTGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 483
Start on reference sequence 115
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR1D
Symbol Nomenclature : POLR1D
SYNONYM : AC19; POLR1C; RPA16; RPA9; RPAC2; RPC16; RPO1-3; TCS2
Designation : DNA-directed RNA polymerase I subunit D|DNA-directed RNA polymerases I and III subunit RPAC2|RNA polymerases I and III subunit AC2
Full Nomenclature : polymerase (RNA) I polypeptide D, 16kDa
GENEID : 51082
HGNC : 20422
MIM : 613715
Vega : OTTHUMG00000016635
Target GenBank: BC015319.2

 

Reference Sequence Alignment

  

HsCD00289277        ATGGAAGAGGATCAGGAGCTGGAGAGGAAAGCAATAGAAGAACTGCTTAAGGAGGCAAAA
NM_152705.2         ATGGAAGAGGATCAGGAGCTGGAGAGGAAAGCAATAGAAGAACTGCTTAAGGAGGCAAAA
XM_005266414.1      ATGGAAGAGGATCAGGAGCTGGAGAGGAAAGCAATAGAAGAACTGCTTAAGGAGGCAAAA
                    ************************************************************

HsCD00289277        CGTGGGAAAACTAGAGCTGAAACAATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCT
NM_152705.2         CGTGGGAAAACTAGAGCTGAAACAATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCT
XM_005266414.1      CGTGGGAAAACTAGAGCTGAAACAATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCT
                    ************************************************************

HsCD00289277        AGCACCAATAAAAGATTTCTAATTAACACAATTAAAAACACATTGCCCTCTCATAAAGAG
NM_152705.2         AGCACCAATAAAAGATTTCTAATTAACACAATTAAAAACACATTGCCCTCTCATAAAGAG
XM_005266414.1      AGCACCAATAAAAGATTTCTAATTAACACAATTAAAAACACATTGCCCTCTCATAAAGAG
                    ************************************************************

HsCD00289277        CAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAGAGCCAGGCCCAGAAAGAA
NM_152705.2         CAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAGAGCCAGGCCCAGAAAGAA
XM_005266414.1      CAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAGAGCCAGGCCCAGAAAGAA
                    ************************************************************

HsCD00289277        GAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCTCGAGGTTCC
NM_152705.2         GAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCTCGAGGTTCC
XM_005266414.1      GAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCTCGAGGTTCC
                    ************************************************************

HsCD00289277        GCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAAC
NM_152705.2         GCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAAC
XM_005266414.1      GCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAAC
                    ************************************************************

HsCD00289277        CGGCGGTGC
NM_152705.2         CGGCGGTGA
XM_005266414.1      CGGCGGTGA
                    ********.

Pathways

Panther : General transcription by RNA polymerase I
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Transcription
WikiPathway : Eukaryotic Transcription Initiation

Protein

UniProt : Q9Y2S0
HPRD : 14717
HPRD : 17877

Clone

Cloning Information : 472514
HIP Master Clone ID : 395432
Original Clone ID : 9548

Organism


TAX_ID : 9606
Species Specific ID: 51082

Genome

Chromosome : 13
Map Location : 13q12.2
Ensembl : ENSG00000186184

Reagents

Labome : POLR1D-antibody