DNASU Plasmid Repository • 480.965.5697 | Email

UBE2V1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2V1
Gene Name:  ubiquitin-conjugating enzyme E2 variant 1
Sequence             
Original Clone ID: 9906
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00289285

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 444nts         Open reading frame : 1 to 444
Reference Sequence Alignment

ATGGCAGCCACCACGGGCTCGGGAGTAAAAGTCCCTCGCAATTTCCGACTGTTGGAAGAA
CTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTAGAAGATGAC
GAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGAACAATTTAT
GAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAAGCACCCCCC
TTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAATGGAGTGGTG
GACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATCAAAGTTGTC
CTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCTCAGCCGCCC
GAAGGACAGTGTTACAGCAATTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 454
Start on reference sequence 11
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2V1
Symbol Nomenclature : UBE2V1
SYNONYM : CIR1; CROC-1; CROC1; UBE2V; UEV-1; UEV1; UEV1A
Designation : DNA-binding protein|TRAF6-regulated IKK activator 1 beta Uev1A
Full Nomenclature : ubiquitin-conjugating enzyme E2 variant 1
GENEID : 7335
Locus Tag : P/OKcl.19
HGNC : 12494
MIM : 602995
Vega : OTTHUMG00000152626
Target GenBank: BC000468.2

 

Reference Sequence Alignment

  

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         ATGGCGGGCGCCGAGGACTGGCCGGGCCAGCAGCTGGAGCTGGACGAGGACGAGGCGTCT
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         TGTTGCCGCTGGGGCGCGCAGCACGCCGGGGCCCGCGAGCTGGCTGCGCTCTACTCGCCA
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         GGCAAGCGCCTCCAGGAGTGGTGCTCTGTGATCCTGTGCTTCAGCCTCATCGCCCACAAC
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         --------------------------------------ATGCCAGGAGAGGTTCAAGCGT
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         CTGGTCCATCTCCTGCTGCTGGCCCGCTGGGAGGACACACCCCTCGTCATACTCGGTGTT
NM_199144.2         --------------------------------------ATGCCAGGAGAGGTTCAAGCGT
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      --------------------------------------ATGCCAGGAGAGGTTCAAGCGT
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         CTTACCTGAAGTCACAAAGCAAACTGAGTGATG---------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         GTTGCAGGGGCTCTCATTGCTGACTTCTTGTCTGGCCTGGTACACTGGGGTGCTGACACA
NM_199144.2         CTTACCTGAAGTCACAAAGCAAACTGAGTGATG---------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      CTTACCTGAAGTCACAAAGCAAACTGAGTGATG---------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------AAGGAA
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         TGGGGCTCTGTGGAGCTGCCCATTGTGGGGAAGGCTTTCATCCGACCCTTCCGGGAGCAC
NM_199144.2         ------------------------------------------------------AAGGAA
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------AAGGAA
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         GACTTGAACCTAGAAAATTTCACTG-----------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         CACATTGACCCGACAGCTATCACACGGCACGACTTCATCGAGACCAACGGGGACAACTGC
NM_199144.2         GACTTGAACCTAGAAAATTTCACTG-----------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      GACTTGAACCTAGAAAATTTCACTG-----------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         CTGGTGACACTGCTGCCGCTGCTAAACATGGCCTACAAGTTCCGCACCCACAGCCCTGAA
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         GCCCTGGAGCAGCTATACCCCTGGGAGTGCTTCGTCTTCTGCCTGATCATCTTCGGCACC
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        --------------------------------------ATGGCAGCCACCACGGG-----
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         TTCACCAACCAGATCCACAAGTGGTCGCACACGTACTTTGGGCTGCCACGCTGGGTCACC
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ------------------------------------------------------------
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        ------------------------------------------------------------
NM_021988.5         ------------------------------------------------------------
NM_001257395.1      ------------------------------------------------------------
NM_199203.2         CTCCTGCAGGACTGGCATGTCATCCTGCCACGTAAACACCATCGCATCCACCACGTCTCA
NM_199144.2         ------------------------------------------------------------
NM_001032288.2      ----------------------------------------ATGGCAGCCACCACG-----
NM_001257393.1      ------------------------------------------------------------
                                                                                

HsCD00289285        --------------------------CTCGGGAGTAAAAGTCCCTCGCAATTTCCGACTG
NM_021988.5         --------------------------CAAAGGAGTAAAAGTCCCTCGCAATTTCCGACTG
NM_001257395.1      ------------------ATGGCAGCCACCACGGGCTCGGTCCCTCGCAATTTCCGACTG
NM_199203.2         CCCCACGAGACCTACTTCTGCATCACCACAGGAGTAAAAGTCCCTCGCAATTTCCGACTG
NM_199144.2         --------------------------CAAAGGAGTAAAAGTCCCTCGCAATTTCCGACTG
NM_001032288.2      ------------------------GGCTCGGGAGTAAAAGTCCCTCGCAATTTCCGACTG
NM_001257393.1      --------------------------CAAAGGAGTAAAAGTCCCTCGCAATTTCCGACTG
                                              *:. . .* .:..*********************

HsCD00289285        TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_021988.5         TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_001257395.1      TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_199203.2         TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_199144.2         TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_001032288.2      TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
NM_001257393.1      TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA
                    ************************************************************

HsCD00289285        GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_021988.5         GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_001257395.1      GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_199203.2         GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_199144.2         GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_001032288.2      GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
NM_001257393.1      GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA
                    ************************************************************

HsCD00289285        ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_021988.5         ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_001257395.1      ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_199203.2         ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_199144.2         ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_001032288.2      ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
NM_001257393.1      ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA
                    ************************************************************

HsCD00289285        GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_021988.5         GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_001257395.1      GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_199203.2         GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_199144.2         GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_001032288.2      GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
NM_001257393.1      GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT
                    ************************************************************

HsCD00289285        GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_021988.5         GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_001257395.1      GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_199203.2         GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_199144.2         GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_001032288.2      GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
NM_001257393.1      GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC
                    ************************************************************

HsCD00289285        AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_021988.5         AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_001257395.1      AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_199203.2         AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_199144.2         AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_001032288.2      AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
NM_001257393.1      AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT
                    ************************************************************

HsCD00289285        CAGCCGCCCGAAGGACAGTGTTACAGCAATTAC
NM_021988.5         CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
NM_001257395.1      CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
NM_199203.2         CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
NM_199144.2         CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
NM_001032288.2      CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
NM_001257393.1      CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
                    ********************************.

Pathways

NCI : IL1-mediated signaling events
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream TCR signaling
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK1 recruits IKK complex
Reactome : IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TCR signaling
Reactome : TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : IL-1 signaling pathway

Clone

Cloning Information : 472522
HIP Master Clone ID : 395440
Original Clone ID : 9906

Organism


TAX_ID : 9606
Species Specific ID: 7335

Genome

Chromosome : 20
Map Location : 20q13.2
Ensembl : ENSG00000244687

Reagents

Labome : UBE2V1-antibody