DNASU Plasmid Repository • 480.965.5697 | Email

ADI1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADI1
Gene Name:  acireductone dioxygenase 1
Sequence             
Original Clone ID: 10278
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00289291

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 540nts         Open reading frame : 1 to 540
Reference Sequence Alignment

ATGGTGCAGGCCTGGTATATGGACGACGCCCCGGGCGACCCGCGGCAACCCCACCGCCCC
GACCCCGGCCGCCCAGTGGGCCTGGAGCAGCTGCGGCGGCTCGGGGTGCTCTACTGGAAG
CTGGATGCTGACAAATATGAGAATGATCCAGAATTAGAAAAGATCCGAAGAGAGAGGAAC
TACTCCTGGATGGACATCATAACCATATGCAAAGATAAACTACCAAATTATGAAGAAAAG
ATTAAGATGTTCTACGAGGAGCATTTGCACTTGGACGATGAGATCCGCTACATCCTGGAT
GGCAGTGGGTACTTCGATGTGAGGGACAAGGAGGACCAGTGGATCCGGATCTTCATGGAG
AAGGGAGACATGGTGACGCTCCCCGCGGGGATCTATCACCGCTTCACGGTGGACGAGAAG
AACTACACGAAGGCCATGCGGCTGTTTGTGGGAGAACCGGTGTGGACAGCGTACAACCGG
CCCGCTGACCATTTTGAAGCCCGCGGGCAGTACGTGAAATTTCTGGCACAGACCGCCTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 573
Start on reference sequence 34
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ADI1
Symbol Nomenclature : ADI1
SYNONYM : APL1; ARD; Fe-ARD; MTCBP1; Ni-ARD; SIPL; mtnD
Designation : 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase|MT1-MMP cytoplasmic tail-binding protein-1|acireductone dioxygenase (Fe(2+)-requiring)|acireductone dioxygenase (Ni(2+)-requiring)|membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1|submergence induced protein 2|submergence-induced protein-like factor
Full Nomenclature : acireductone dioxygenase 1
GENEID : 55256
Locus Tag : HMFT1638
HGNC : 30576
MIM : 613400
Vega : OTTHUMG00000112441
Target GenBank: BC001467.2

 

Reference Sequence Alignment

  

HsCD00289291        ATGGTGCAGGCCTGGTATATGGACGACGCCCCGGGCGACCCGCGGCAACCCCACCGCCCC
XM_005264696.1      ------------------ATGTCCGTGAAATCTTCAAAACTTATGTTCCTCTGCCATGGC
NM_018269.3         ATGGTGCAGGCCTGGTATATGGACGACGCCCCGGGCGACCCGCGGCAACCCCACCGCCCC
                                      *** .**: ... *   ..*.*  . * :.* * .**.   *

HsCD00289291        GACCCCGGCCGCCCAGTGGGCCTGGAGCAGCTGCGGCGGCTCGGGGTGCTCTACTGGAAG
XM_005264696.1      TCCAGCCGGTCCCTCCATTCGGGGTCCCTGACTTCCTGCAACACTGGAGTTTGTTGTTCA
NM_018269.3         GACCCCGGCCGCCCAGTGGGCCTGGAGCAGCTGCGGCGGCTCGGGGTGCTCTACTGGAAG
                     .*. * *   ** . :      * . *:*.      * .:*.  * . * *. ** :..

HsCD00289291        CTGGATGCTGACAAATATGAGAATGATCCAGAATTAGAAAAGATCCGAAGAGAGAGGAAC
XM_005264696.1      CTGGATGCTGACAAATATGAGAATGATCCAGAATTAGAAAAGATCCGAAGAGAGAGGAAC
NM_018269.3         CTGGATGCTGACAAATATGAGAATGATCCAGAATTAGAAAAGATCCGAAGAGAGAGGAAC
                    ************************************************************

HsCD00289291        TACTCCTGGATGGACATCATAACCATATGCAAAGATAAACTACCAAATTATGAAGAAAAG
XM_005264696.1      TACTCCTGGATGGACATCATAACCATATGCAAAGATAAACTACCAAATTATGAAGAAAAG
NM_018269.3         TACTCCTGGATGGACATCATAACCATATGCAAAGATAAACTACCAAATTATGAAGAAAAG
                    ************************************************************

HsCD00289291        ATTAAGATGTTCTACGAGGAGCATTTGCACTTGGACGATGAGATCCGCTACATCCTGGAT
XM_005264696.1      ATTAAGATGTTCTACGAGGAGCATTTGCACTTGGACGATGAGATCCGCTACATCCTGGAT
NM_018269.3         ATTAAGATGTTCTACGAGGAGCATTTGCACTTGGACGATGAGATCCGCTACATCCTGGAT
                    ************************************************************

HsCD00289291        GGCAGTGGGTACTTCGATGTGAGGGACAAGGAGGACCAGTGGATCCGGATCTTCATGGAG
XM_005264696.1      GGCAGTGGGTACTTCGATGTGAGGGACAAGGAGGACCAGTGGATCCGGATCTTCATGGAG
NM_018269.3         GGCAGTGGGTACTTCGATGTGAGGGACAAGGAGGACCAGTGGATCCGGATCTTCATGGAG
                    ************************************************************

HsCD00289291        AAGGGAGACATGGTGACGCTCCCCGCGGGGATCTATCACCGCTTCACGGTGGACGAGAAG
XM_005264696.1      AAGGGAGACATGGTGACGCTCCCCGCGGGGATCTATCACCGCTTCACGGTGGACGAGAAG
NM_018269.3         AAGGGAGACATGGTGACGCTCCCCGCGGGGATCTATCACCGCTTCACGGTGGACGAGAAG
                    ************************************************************

HsCD00289291        AACTACACGAAGGCCATGCGGCTGTTTGTGGGAGAACCGGTGTGGACAGCGTACAACCGG
XM_005264696.1      AACTACACGAAGGCCATGCGGCTGTTTGTGGGAGAACCGGTGTGGACAGCGTACAACCGG
NM_018269.3         AACTACACGAAGGCCATGCGGCTGTTTGTGGGAGAACCGGTGTGGACAGCGTACAACCGG
                    ************************************************************

HsCD00289291        CCCGCTGACCATTTTGAAGCCCGCGGGCAGTACGTGAAATTTCTGGCACAGACCGCCTAC
XM_005264696.1      CCCGCTGACCATTTTGAAGCCCGCGGGCAGTACGTGAAATTTCTGGCACAGACCGCCTAG
NM_018269.3         CCCGCTGACCATTTTGAAGCCCGCGGGCAGTACGTGAAATTTCTGGCACAGACCGCCTAG
                    *********************************************************** 

Pathways

Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of polyamines
Reactome : Methionine salvage pathway
Reactome : Sulfur amino acid metabolism

Protein

UniProt : Q9BV57
HPRD : 17607

Clone

Cloning Information : 472528
HIP Master Clone ID : 395446
Original Clone ID : 10278

Organism


TAX_ID : 9606
Species Specific ID: 55256

Genome

Chromosome : 2
Map Location : 2p25.3
Ensembl : ENSG00000182551

Reagents

Labome : ADI1-antibody