DNASU Plasmid Repository • 480.965.5697 | Email

AAAS (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AAAS
Gene Name:  achalasia, adrenocortical insufficiency, alacrimia
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015472.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002918

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1641nts         Open reading frame : 1 to 1641
Reference Sequence Alignment

ATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAG
CACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGC
CAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGG
CTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGC
ATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAA
GAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGG
GCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATC
GCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCAC
CCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCC
AGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCC
TGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGG
ACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCT
CACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTC
TCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTC
CCCCTTCCCTGGTTTCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGC
AAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACT
TGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGC
AGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAA
CGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGAT
CTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCAC
TCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGG
GTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAG
CTCCTTCCCTGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTC
CATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCC
CACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGG
GCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAG
ACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCAC
TCCCCACATTCCCACCTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1775
Start on reference sequence 135
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AAAS
Symbol Nomenclature : AAAS
SYNONYM : AAA; AAASb; ADRACALA; ADRACALIN; ALADIN
Designation : Allgrove, triple-A|aladin
Full Nomenclature : achalasia, adrenocortical insufficiency, alacrimia
GENEID : 8086
Locus Tag : GL003
GI : 61372195
GenBank Accession : AY891872
HGNC : 13666
MIM : 605378
Vega : OTTHUMG00000169729
Target GenBank: BC000659

 

Reference Sequence Alignment

  

HsCD00002918        ATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAG
NM_001173466.1      ATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAG
NM_015665.5         ATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAG
                    ************************************************************

HsCD00002918        CACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGC
NM_001173466.1      CACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGC
NM_015665.5         CACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGC
                    ************************************************************

HsCD00002918        CAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGG
NM_001173466.1      CAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGG
NM_015665.5         CAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGG
                    ************************************************************

HsCD00002918        CTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGC
NM_001173466.1      CTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGC
NM_015665.5         CTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGC
                    ************************************************************

HsCD00002918        ATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAA
NM_001173466.1      ATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAA
NM_015665.5         ATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAA
                    ************************************************************

HsCD00002918        GAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGG
NM_001173466.1      GAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGG
NM_015665.5         GAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGG
                    ************************************************************

HsCD00002918        GCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATC
NM_001173466.1      GCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATC
NM_015665.5         GCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATC
                    ************************************************************

HsCD00002918        GCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCAC
NM_001173466.1      GCTGAATTTGCCCAAGTCACAAATTG----------------------------------
NM_015665.5         GCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCAC
                    **************************                                  

HsCD00002918        CCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCC
NM_001173466.1      ------------------------------------------------------------
NM_015665.5         CCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCC
                                                                                

HsCD00002918        AGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCC
NM_001173466.1      -----CACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCC
NM_015665.5         AGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCC
                         *******************************************************

HsCD00002918        TGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGG
NM_001173466.1      TGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGG
NM_015665.5         TGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGG
                    ************************************************************

HsCD00002918        ACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCT
NM_001173466.1      ACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCT
NM_015665.5         ACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCT
                    ************************************************************

HsCD00002918        CACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTC
NM_001173466.1      CACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTC
NM_015665.5         CACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTC
                    ************************************************************

HsCD00002918        TCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTC
NM_001173466.1      TCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTC
NM_015665.5         TCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTC
                    ************************************************************

HsCD00002918        CCCCTTCCCTGGTTTCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGC
NM_001173466.1      CCCCTTCCCTGGTTCCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGC
NM_015665.5         CCCCTTCCCTGGTTCCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGC
                    ************** *********************************************

HsCD00002918        AAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACT
NM_001173466.1      AAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACT
NM_015665.5         AAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACT
                    ************************************************************

HsCD00002918        TGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGC
NM_001173466.1      TGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGC
NM_015665.5         TGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGC
                    ************************************************************

HsCD00002918        AGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAA
NM_001173466.1      AGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAA
NM_015665.5         AGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAA
                    ************************************************************

HsCD00002918        CGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGAT
NM_001173466.1      CGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGAT
NM_015665.5         CGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGAT
                    ************************************************************

HsCD00002918        CTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCAC
NM_001173466.1      CTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCAC
NM_015665.5         CTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCAC
                    ************************************************************

HsCD00002918        TCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGG
NM_001173466.1      TCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGG
NM_015665.5         TCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGG
                    ************************************************************

HsCD00002918        GTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAG
NM_001173466.1      GTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAG
NM_015665.5         GTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAG
                    ************************************************************

HsCD00002918        CTCCTTCCCTGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTC
NM_001173466.1      CTCCTTCCCTGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTC
NM_015665.5         CTCCTTCCCTGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTC
                    ************************************************************

HsCD00002918        CATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCC
NM_001173466.1      CATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCC
NM_015665.5         CATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCC
                    ************************************************************

HsCD00002918        CACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGG
NM_001173466.1      CACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGG
NM_015665.5         CACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGG
                    ************************************************************

HsCD00002918        GCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAG
NM_001173466.1      GCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAG
NM_015665.5         GCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAG
                    ************************************************************

HsCD00002918        ACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCAC
NM_001173466.1      ACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCAC
NM_015665.5         ACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCAC
                    ************************************************************

HsCD00002918        TCCCCACATTCCCACCTCTTG
NM_001173466.1      TCCCCACATTCCCACCTCTAA
NM_015665.5         TCCCCACATTCCCACCTCTAA
                    *******************:.

Pathways

Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Export of Viral Ribonucleoproteins from Nucleus
Reactome : Gene Expression
Reactome : Glucose transport
Reactome : Glycogen storage diseases
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Hexose transport
Reactome : Host Interactions of HIV factors
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Interactions of Rev with host cellular proteins
Reactome : Interactions of Vpr with host cellular proteins
Reactome : Interferon Signaling
Reactome : Late Phase of HIV Life Cycle
Reactome : M Phase
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of non-coding RNA
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Myoclonic epilepsy of Lafora
Reactome : NEP/NS2 Interacts with the Cellular Export Machinery
Reactome : Nuclear Envelope Breakdown
Reactome : Nuclear Pore Complex (NPC) Disassembly
Reactome : Nuclear import of Rev protein
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Regulation of Glucokinase by Glucokinase Regulatory Protein
Reactome : Rev-mediated nuclear export of HIV RNA
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNA Derived from an Intronless Transcript
Reactome : Transport of Mature mRNA derived from an Intron-Containing Transcript
Reactome : Transport of Mature mRNAs Derived from Intronless Transcripts
Reactome : Transport of Ribonucleoproteins into the Host Nucleus
Reactome : Transport of the SLBP Dependant Mature mRNA
Reactome : Transport of the SLBP independent Mature mRNA
Reactome : Vpr-mediated nuclear import of PICs
Reactome : snRNP Assembly

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q9NRG9
UniProt : Q5JB47
HPRD : 05646

Clone

Cloning Information : 15472
HIP Master Clone ID : 29671
Original Clone ID : FLH015472.01L

Organism


TAX_ID : 9606
Species Specific ID: 8086

Genome

Chromosome : 12
Map Location : 12q13
Ensembl : ENSG00000094914

Reagents

Labome : AAAS-antibody