| Gene: |
Gene Symbol:
STYX Gene Name: None Sequence |
|---|---|
| Original Clone ID: | 8698a4BSt2p1 |
| Keyword: | None |
| Species: | Homo sapiens |
| Type: | cDNA |
| Vector Name: | pSGX4 Format: CLOSED |
| Source: | New York SGX Research Center for Structural Genomics |
| Description: | None |
| Comments: | "N-terminal 6-His and Smt3, cleavable, TOPO; clone failed to grow" |
| Mutation/ Discrepancy : |
Yes / No |
| Publications: |
PMID: 18058037 Title: Structural genomics of protein phosphatases |
| Authors: |
PSI New York SGX Research Center for Structural Genomics |
|
HsCD00292711 Price: Login for Pricing NOT AVAILABLE No restriction Special MTA: PSI/Smt3/SUMO |
Insert sequence: 459nts
Open reading frame : 51 to 509
AGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTTAGACGAGAGA
TGCAGGAAATTTTACCTGGATTGTTCTTAGGCCCATATTCATCTGCTATGAAAAGCAAGC
TACCTGTACTACAGAAACATGGAATAACCCATATAATATGCATACGACAAAATATTGAAG
CAAACTTTATTAAACCAAACTTTCAGCAGTTATTTAGATATTTAGTCCTGGATATTGCAG
ATAATCCAGTTGAAAATATAATACGTTTTTTCCCTATGACTAAGGAATTTATTGATGGGA
GCTTACAAATGGGAGGAAAAGTTCTTGTGCATTGTAATGCAGGGATCTCCAGAAGTGCAG
CCTTTGTTATTGCATACATTATGGAAACATTTGGAATGAAGTACAGAGATGCTTTTGCTT
ATGTTCAAGAAAGAAGATTTTGTATTAATCCTAATGCTGGATTTGTCCATCAACTTCAGG
AATATGAAGCCATCTACCTAGCAAAATAAGAGTAACTCGAGCACCACCACCACCACCACT
GAGATCCG
|
| Coding Sequence Details | |
|---|---|
| Insert Sequence Verified?: Y | Verification Method: Sequence Verification |
|
Reference Sequence Annotations: End on reference sequence 459 Start on reference sequence 1 |
|
|
Mutations: G120C; |
Discrepancy: None |
5' Linker Sequence:
ACAGAGAACAGATTGGTGGATCCCTT |
|
| 3' Linker Sequence: None | |
| Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
|---|---|
| Antibiotic Selection: |
Host Type:
bacterial
Marker:
kanamycin Bacterial Selection Condition: 50ug/mL kanamycin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors. |
| Protein Expression Results: |
ProteinExpressed: Protein_Confirmed ProteinPurified: Protein_Purified SolubleProtein: Protein_Soluble Find experimental protocols in NYSGXRC-8698a |
| Recommended expression in: | BL21(DE3)-Codon+RIL |
Powered by LabGenius |
||
| Vector Name: | pSGX4 |
pSGX4 in advanced viewed |
| Synonyms: | pSGX-4, pSGX4_BS | |
| Sequencing Primer: | Forward:
T7
Reverse: T7 terminator |
|
| Description: | Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning. | |
| Comments: | Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites. | |
| Size (bp): | 5611 | |
| Parent Vector: | None | |
| Empty Vector: | None | |
| Properties: | TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker | |
| Author Name: |
NYSGXRC |
|
| Publications: | None | |
| Vector Map: |
Vector Sequence:
|
|
| Sequence: |
Vector Features:
| Type | Name | Description | Start Position | End Position |
|---|---|---|---|---|
| TOPO recognition site | TOPO | TOPO cloning site | 5435 | 5444 |
| bacterial origin | ColE | ColE1 bacterial origin of replication | 1421 | 2103 |
| gene fragment | ROP | ROP | 2527 | 2703 |
| promoter | T7 | T7 promoter | 4984 | 5003 |
| protease cleavage site | ULP site | ULP cleavage site (recognizes the tertiary structure of SUMO) | 5140 | 5140 |
| repressor protein gene | LacI | lacI cds | 3515 | 4351 |
| ribosome binding site | RBS | ribosome binding site (RBS) | 5062 | 5068 |
| selectable marker | KanR | kanamycin resistance gene | 563 | 1375 |
| tag | Smt3 | Smt3 tag | 5140 | 5424 |
| tag | His | 6xHis tag | 5083 | 5100 |
| trxn regulatory element | lac operator | lac operator | 5003 | 5025 |
| trxn termination sequence | T7 term | T7 termination sequence | 5539 | 5585 |
| Cloning Information: |
475621 |
|---|---|
| HIP Master Clone ID: |
397127 |
| Original Clone ID: |
8698a4BSt2p1 |
| SMART domain: |
DSPc : Dual specificity phosphatase, catalytic domain |
| SMART domain: |
PTPc_motif : Protein tyrosine phosphatase, catalytic domain motif |
| Structural Annotation Wiki: |
TOPSAN |
| TargetTrack - Experimental data: |
NYSGXRC-8698a |
| Species Specific ID: | None |
| Target GenBank: | NP_660294 |
