DNASU Plasmid Repository • 480.965.5697 | Email

TCP1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCP1
Gene Name:  t-complex 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015486.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002937

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1671nts         Open reading frame : 1 to 1671
Reference Sequence Alignment

ATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAA
AACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGC
TTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACC
ATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGAT
CTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTC
CTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGC
TATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACA
GATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATC
ATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAA
TACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCC
CATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTG
GGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGC
CTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTG
GACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCA
ACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTT
GTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCC
AAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTT
GAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAG
CTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCA
AATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAG
AGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCC
ATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAG
TTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCC
ACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGT
AAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAA
GCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCT
GCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGAT
AAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1796
Start on reference sequence 126
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCP1
Symbol Nomenclature : TCP1
SYNONYM : CCT-alpha; CCT1; CCTa; D6S230E; TCP-1-alpha
Designation : T-complex protein 1 subunit alpha|T-complex protein 1, alpha subunit|tailless complex polypeptide 1
Full Nomenclature : t-complex 1
GENEID : 6950
GI : 60655236
GenBank Accession : AY889391
HGNC : 11655
MIM : 186980
Vega : OTTHUMG00000015937
Target GenBank: BC000665

 

Reference Sequence Alignment

  

HsCD00002937      ATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAA
NM_030752.2       ATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAA
                  ************************************************************

HsCD00002937      AACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGC
NM_030752.2       AACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGC
                  ************************************************************

HsCD00002937      TTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACC
NM_030752.2       TTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACC
                  ************************************************************

HsCD00002937      ATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGAT
NM_030752.2       ATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGAT
                  ************************************************************

HsCD00002937      CTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTC
NM_030752.2       CTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTC
                  ************************************************************

HsCD00002937      CTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGC
NM_030752.2       CTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGC
                  ************************************************************

HsCD00002937      TATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACA
NM_030752.2       TATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACA
                  ************************************************************

HsCD00002937      GATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATC
NM_030752.2       GATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATC
                  ************************************************************

HsCD00002937      ATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAA
NM_030752.2       ATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAA
                  ************************************************************

HsCD00002937      TACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCC
NM_030752.2       TACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCC
                  ************************************************************

HsCD00002937      CATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTG
NM_030752.2       CATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTG
                  ************************************************************

HsCD00002937      GGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGC
NM_030752.2       GGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGC
                  ************************************************************

HsCD00002937      CTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTG
NM_030752.2       CTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTG
                  ************************************************************

HsCD00002937      GACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCA
NM_030752.2       GACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCA
                  ************************************************************

HsCD00002937      ACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTT
NM_030752.2       ACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTT
                  ************************************************************

HsCD00002937      GTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCC
NM_030752.2       GTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCC
                  ************************************************************

HsCD00002937      AAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTT
NM_030752.2       AAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTT
                  ************************************************************

HsCD00002937      GAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAG
NM_030752.2       GAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAG
                  ************************************************************

HsCD00002937      CTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCA
NM_030752.2       CTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCA
                  ************************************************************

HsCD00002937      AATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAG
NM_030752.2       AATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAG
                  ************************************************************

HsCD00002937      AGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCC
NM_030752.2       AGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCC
                  ************************************************************

HsCD00002937      ATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAG
NM_030752.2       ATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAG
                  ************************************************************

HsCD00002937      TTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCC
NM_030752.2       TTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCC
                  ************************************************************

HsCD00002937      ACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGT
NM_030752.2       ACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGT
                  ************************************************************

HsCD00002937      AAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAA
NM_030752.2       AAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAA
                  ************************************************************

HsCD00002937      GCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCT
NM_030752.2       GCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCT
                  ************************************************************

HsCD00002937      GCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGAT
NM_030752.2       GCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGAT
                  ************************************************************

HsCD00002937      AAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTAG
NM_030752.2       AAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTGA
                  *************************************************..

Pathways

Reactome : Association of TriC/CCT with target proteins during biosynthesis
Reactome : Chaperonin-mediated protein folding
Reactome : Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding
Reactome : Folding of actin by CCT/TriC
Reactome : Formation of tubulin folding intermediates by CCT/TriC
Reactome : Metabolism of proteins
Reactome : Prefoldin mediated transfer of substrate to CCT/TriC
Reactome : Protein folding

Protein

UniProt : E7ERF2
UniProt : E7EQR6
UniProt : P17987
HPRD : 01748

Clone

Cloning Information : 15486
HIP Master Clone ID : 29685
Original Clone ID : FLH015486.01X

Organism


TAX_ID : 9606
Species Specific ID: 6950

Genome

Chromosome : 6
Map Location : 6q25.3-q26
Ensembl : ENSG00000120438

Reagents

Labome : TCP1-antibody