DNASU Plasmid Repository • 480.965.5697 | Email

NRG2 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NRG2
Gene Name:  neuregulin 2
Sequence             
Original Clone ID: FLH481135.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00294880

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2556nts        
Open reading frame : 1 to 2556
Reference Sequence Alignment

ATGCGGCAGGTTTGCTGCTCAGCGCTGCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGC
AGCTACAGCGACAGCAGCAGCAGCAGCAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGC
AGCGAGAGCGGCAGCAGCAGCAGGAGCAGCAGCAACAACAGCAGCATCTCTCGTCCCGCT
GCGCCCCCAGAGCCGCGGCCGCAGCAACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGA
GCCGCCGCCCGTTCGCGAGCCGCAGCCGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGC
TTCTCCATGCTGCTCTTCGGTGTGTCGCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTG
CAGGACCAGGCGTACAAGGCACCCGTGGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCA
GCCGGCGGCTCCAGCTCCAACAGCACCCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTG
GTAAAGGTGCTGGACAAGTGGCCGCTCCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATC
AGCGTGGGCTCCTGTGTGCCGCTCGAAAGGAACCAGCGCTACATCTTTTTCCTGGAGCCC
ACGGAACAGCCCTTAGTCTTTAAGACGGCCTTTGCCCCCCTCGATACCAACGGCAAAAAT
CTCAAGAAAGAGGTGGGCAAGATCCTGTGCACTGACTGCGCCACCCGGCCCAAGTTGAAG
AAGATGAAGAGCCAGACGGGACAGGTGGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCA
GCCGGTAATCCCCAGCCTTCCTACCGTTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGC
CGAGACATTCGCATCAAATATGGCAACGGCAGAAAGAACTCACGACTACAGTTCAACAAG
GTGAAGGTGGAGGACGCTGGGGAGTATGTCTGCGAGGCCGAGAACATCCTGGGGAAGGAC
ACCGTCCGGGGCCGGCTTTACGTCAACAGCGTGAGCACCACCCTGTCATCCTGGTCGGGG
CACGCCCGGAAGTGCAACGAGACAGCCAAGTCCTATTGCGTCAATGGAGGCGTCTGCTAC
TACATCGAGGGCATCAACCAGCTCTCCTGCAAGTGTCCTGTGGGATACACCGGGGACAGG
TGTCAGCAGTTCGCAATGGTCAACTTCTCCAAGCACCTTGGATTTGAATTAAAGGAAGCC
GAGGAGCTGTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTC
GTGGGCATCGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCAC
AACCACCTCCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCC
AGCCACCCCCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTG
CCAGCCACAGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCC
TGTTCTCCTTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGC
CACACGTGGAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATG
CTATCATCAGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGG
CGGGCAGCAGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGAT
TCCGTGGACTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACG
CCCGCGCGCCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTC
GAGATCACGTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGT
TACCGCCTGGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCC
GGACCCGGGCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTAT
TACCCCGCGGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGC
AGCCTGCCTGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAG
TGCGCGCCCCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCG
GGGCCCCGGCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCG
GCGAGGGACTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGAC
GACGACGCGGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTG
CGTGGGGCGCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGC
AGGACTTACTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGG
CCGCCCCCGCGGGCCAAGCAGGACTCGGCGCCACTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 226
End on reference sequence 2784
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618
selectable marker SpnR spectinomycin resistance gene 3154 4164

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NRG2
Symbol Nomenclature : NRG2
SYNONYM : DON1; HRG2; NTAK
Designation : divergent of neuregulin-1|neural- and thymus-derived activator for ErbB kinases|pro-NRG2|pro-neuregulin-2, membrane-bound isoform
Full Nomenclature : neuregulin 2
GENEID : 9542
GI : 187252590
GenBank Accession : BC166615
HGNC : 7998
MIM : 603818
Vega : OTTHUMG00000129241
Target GenBank: NM_013983.1

 

Reference Sequence Alignment

  

HsCD00294880      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGCGGCAGGTTTGCTGCTCAGCGCT
NM_004883.2       ----------------------------------ATGCGGCAGGTTTGCTGCTCAGCGCT
NM_013983.2       ----------------------------------ATGCGGCAGGTTTGCTGCTCAGCGCT
NM_013981.3       ----------------------------------ATGCGGCAGGTTTGCTGCTCAGCGCT
NM_013982.2       ----------------------------------ATGCGGCAGGTTTGCTGCTCAGCGCT
                                                    **************************

HsCD00294880      GCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGCAGCTACAGCGACAGCAGCAGCAGCAG
NM_004883.2       GCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGCAGCTACAGCGACAGCAGCAGCAGCAG
NM_013983.2       GCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGCAGCTACAGCGACAGCAGCAGCAGCAG
NM_013981.3       GCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGCAGCTACAGCGACAGCAGCAGCAGCAG
NM_013982.2       GCCGCCGCCGCCACTGGAGAAGGGTCGGTGCAGCAGCTACAGCGACAGCAGCAGCAGCAG
                  ************************************************************

HsCD00294880      CAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCGAGAGCGGCAGCAGCAGCAGGAG
NM_004883.2       CAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCGAGAGCGGCAGCAGCAGCAGGAG
NM_013983.2       CAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCGAGAGCGGCAGCAGCAGCAGGAG
NM_013981.3       CAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCGAGAGCGGCAGCAGCAGCAGGAG
NM_013982.2       CAGCGAGAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCGAGAGCGGCAGCAGCAGCAGGAG
                  ************************************************************

HsCD00294880      CAGCAGCAACAACAGCAGCATCTCTCGTCCCGCTGCGCCCCCAGAGCCGCGGCCGCAGCA
NM_004883.2       CAGCAGCAACAACAGCAGCATCTCTCGTCCCGCTGCGCCCCCAGAGCCGCGGCCGCAGCA
NM_013983.2       CAGCAGCAACAACAGCAGCATCTCTCGTCCCGCTGCGCCCCCAGAGCCGCGGCCGCAGCA
NM_013981.3       CAGCAGCAACAACAGCAGCATCTCTCGTCCCGCTGCGCCCCCAGAGCCGCGGCCGCAGCA
NM_013982.2       CAGCAGCAACAACAGCAGCATCTCTCGTCCCGCTGCGCCCCCAGAGCCGCGGCCGCAGCA
                  ************************************************************

HsCD00294880      ACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGAGCCGCCGCCCGTTCGCGAGCCGCAGC
NM_004883.2       ACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGAGCCGCCGCCCGTTCGCGAGCCGCAGC
NM_013983.2       ACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGAGCCGCCGCCCGTTCGCGAGCCGCAGC
NM_013981.3       ACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGAGCCGCCGCCCGTTCGCGAGCCGCAGC
NM_013982.2       ACAGCCGCAGCCCCGCAGCCCCGCAGCCCGGAGAGCCGCCGCCCGTTCGCGAGCCGCAGC
                  ************************************************************

HsCD00294880      CGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGCTTCTCCATGCTGCTCTTCGGTGTGTC
NM_004883.2       CGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGCTTCTCCATGCTGCTCTTCGGTGTGTC
NM_013983.2       CGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGCTTCTCCATGCTGCTCTTCGGTGTGTC
NM_013981.3       CGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGCTTCTCCATGCTGCTCTTCGGTGTGTC
NM_013982.2       CGCCGGCGGCATGAGGCGCGACCCGGCCCCCGGCTTCTCCATGCTGCTCTTCGGTGTGTC
                  ************************************************************

HsCD00294880      GCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTGCAGGACCAGGCGTACAAGGCACCCGT
NM_004883.2       GCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTGCAGGACCAGGCGTACAAGGCACCCGT
NM_013983.2       GCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTGCAGGACCAGGCGTACAAGGCACCCGT
NM_013981.3       GCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTGCAGGACCAGGCGTACAAGGCACCCGT
NM_013982.2       GCTCGCCTGCTACTCGCCCAGCCTCAAGTCAGTGCAGGACCAGGCGTACAAGGCACCCGT
                  ************************************************************

HsCD00294880      GGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCAGCCGGCGGCTCCAGCTCCAACAGCAC
NM_004883.2       GGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCAGCCGGCGGCTCCAGCTCCAACAGCAC
NM_013983.2       GGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCAGCCGGCGGCTCCAGCTCCAACAGCAC
NM_013981.3       GGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCAGCCGGCGGCTCCAGCTCCAACAGCAC
NM_013982.2       GGTGGTGGAGGGCAAGGTACAGGGGCTGGTCCCAGCCGGCGGCTCCAGCTCCAACAGCAC
                  ************************************************************

HsCD00294880      CCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTGGTAAAGGTGCTGGACAAGTGGCCGCT
NM_004883.2       CCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTGGTAAAGGTGCTGGACAAGTGGCCGCT
NM_013983.2       CCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTGGTAAAGGTGCTGGACAAGTGGCCGCT
NM_013981.3       CCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTGGTAAAGGTGCTGGACAAGTGGCCGCT
NM_013982.2       CCGAGAGCCGCCCGCCTCGGGTCGGGTGGCGTTGGTAAAGGTGCTGGACAAGTGGCCGCT
                  ************************************************************

HsCD00294880      CCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATCAGCGTGGGCTCCTGTGTGCCGCTCGA
NM_004883.2       CCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATCAGCGTGGGCTCCTGTGTGCCGCTCGA
NM_013983.2       CCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATCAGCGTGGGCTCCTGTGTGCCGCTCGA
NM_013981.3       CCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATCAGCGTGGGCTCCTGTGTGCCGCTCGA
NM_013982.2       CCGGAGCGGGGGGCTGCAGCGCGAGCAGGTGATCAGCGTGGGCTCCTGTGTGCCGCTCGA
                  ************************************************************

HsCD00294880      AAGGAACCAGCGCTACATCTTTTTCCTGGAGCCCACGGAACAGCCCTTAGTCTTTAAGAC
NM_004883.2       AAGGAACCAGCGCTACATCTTTTTCCTGGAGCCCACGGAACAGCCCTTAGTCTTTAAGAC
NM_013983.2       AAGGAACCAGCGCTACATCTTTTTCCTGGAGCCCACGGAACAGCCCTTAGTCTTTAAGAC
NM_013981.3       AAGGAACCAGCGCTACATCTTTTTCCTGGAGCCCACGGAACAGCCCTTAGTCTTTAAGAC
NM_013982.2       AAGGAACCAGCGCTACATCTTTTTCCTGGAGCCCACGGAACAGCCCTTAGTCTTTAAGAC
                  ************************************************************

HsCD00294880      GGCCTTTGCCCCCCTCGATACCAACGGCAAAAATCTCAAGAAAGAGGTGGGCAAGATCCT
NM_004883.2       GGCCTTTGCCCCCCTCGATACCAACGGCAAAAATCTCAAGAAAGAGGTGGGCAAGATCCT
NM_013983.2       GGCCTTTGCCCCCCTCGATACCAACGGCAAAAATCTCAAGAAAGAGGTGGGCAAGATCCT
NM_013981.3       GGCCTTTGCCCCCCTCGATACCAACGGCAAAAATCTCAAGAAAGAGGTGGGCAAGATCCT
NM_013982.2       GGCCTTTGCCCCCCTCGATACCAACGGCAAAAATCTCAAGAAAGAGGTGGGCAAGATCCT
                  ************************************************************

HsCD00294880      GTGCACTGACTGCGCCACCCGGCCCAAGTTGAAGAAGATGAAGAGCCAGACGGGACAGGT
NM_004883.2       GTGCACTGACTGCGCCACCCGGCCCAAGTTGAAGAAGATGAAGAGCCAGACGGGACAGGT
NM_013983.2       GTGCACTGACTGCGCCACCCGGCCCAAGTTGAAGAAGATGAAGAGCCAGACGGGACAGGT
NM_013981.3       GTGCACTGACTGCGCCACCCGGCCCAAGTTGAAGAAGATGAAGAGCCAGACGGGACAGGT
NM_013982.2       GTGCACTGACTGCGCCACCCGGCCCAAGTTGAAGAAGATGAAGAGCCAGACGGGACAGGT
                  ************************************************************

HsCD00294880      GGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCAGCCGGTAATCCCCAGCCTTCCTACCG
NM_004883.2       GGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCAGCCGGTAATCCCCAGCCTTCCTACCG
NM_013983.2       GGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCAGCCGGTAATCCCCAGCCTTCCTACCG
NM_013981.3       GGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCAGCCGGTAATCCCCAGCCTTCCTACCG
NM_013982.2       GGGTGAGAAGCAATCGCTGAAGTGTGAGGCAGCAGCCGGTAATCCCCAGCCTTCCTACCG
                  ************************************************************

HsCD00294880      TTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGCCGAGACATTCGCATCAAATATGGCAA
NM_004883.2       TTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGCCGAGACATTCGCATCAAATATGGCAA
NM_013983.2       TTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGCCGAGACATTCGCATCAAATATGGCAA
NM_013981.3       TTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGCCGAGACATTCGCATCAAATATGGCAA
NM_013982.2       TTGGTTCAAGGATGGCAAGGAGCTCAACCGCAGCCGAGACATTCGCATCAAATATGGCAA
                  ************************************************************

HsCD00294880      CGGCAGAAAGAACTCACGACTACAGTTCAACAAGGTGAAGGTGGAGGACGCTGGGGAGTA
NM_004883.2       CGGCAGAAAGAACTCACGACTACAGTTCAACAAGGTGAAGGTGGAGGACGCTGGGGAGTA
NM_013983.2       CGGCAGAAAGAACTCACGACTACAGTTCAACAAGGTGAAGGTGGAGGACGCTGGGGAGTA
NM_013981.3       CGGCAGAAAGAACTCACGACTACAGTTCAACAAGGTGAAGGTGGAGGACGCTGGGGAGTA
NM_013982.2       CGGCAGAAAGAACTCACGACTACAGTTCAACAAGGTGAAGGTGGAGGACGCTGGGGAGTA
                  ************************************************************

HsCD00294880      TGTCTGCGAGGCCGAGAACATCCTGGGGAAGGACACCGTCCGGGGCCGGCTTTACGTCAA
NM_004883.2       TGTCTGCGAGGCCGAGAACATCCTGGGGAAGGACACCGTCCGGGGCCGGCTTTACGTCAA
NM_013983.2       TGTCTGCGAGGCCGAGAACATCCTGGGGAAGGACACCGTCCGGGGCCGGCTTTACGTCAA
NM_013981.3       TGTCTGCGAGGCCGAGAACATCCTGGGGAAGGACACCGTCCGGGGCCGGCTTTACGTCAA
NM_013982.2       TGTCTGCGAGGCCGAGAACATCCTGGGGAAGGACACCGTCCGGGGCCGGCTTTACGTCAA
                  ************************************************************

HsCD00294880      CAGCGTGAGCACCACCCTGTCATCCTGGTCGGGGCACGCCCGGAAGTGCAACGAGACAGC
NM_004883.2       CAGCGTGAGCACCACCCTGTCATCCTGGTCGGGGCACGCCCGGAAGTGCAACGAGACAGC
NM_013983.2       CAGCGTGAGCACCACCCTGTCATCCTGGTCGGGGCACGCCCGGAAGTGCAACGAGACAGC
NM_013981.3       CAGCGTGAGCACCACCCTGTCATCCTGGTCGGGGCACGCCCGGAAGTGCAACGAGACAGC
NM_013982.2       CAGCGTGAGCACCACCCTGTCATCCTGGTCGGGGCACGCCCGGAAGTGCAACGAGACAGC
                  ************************************************************

HsCD00294880      CAAGTCCTATTGCGTCAATGGAGGCGTCTGCTACTACATCGAGGGCATCAACCAGCTCTC
NM_004883.2       CAAGTCCTATTGCGTCAATGGAGGCGTCTGCTACTACATCGAGGGCATCAACCAGCTCTC
NM_013983.2       CAAGTCCTATTGCGTCAATGGAGGCGTCTGCTACTACATCGAGGGCATCAACCAGCTCTC
NM_013981.3       CAAGTCCTATTGCGTCAATGGAGGCGTCTGCTACTACATCGAGGGCATCAACCAGCTCTC
NM_013982.2       CAAGTCCTATTGCGTCAATGGAGGCGTCTGCTACTACATCGAGGGCATCAACCAGCTCTC
                  ************************************************************

HsCD00294880      CTGCAAGTGTCCTGTGGGATACACCGGGGACAGGTGTCAG------------------CA
NM_004883.2       CTGCAAATGTCCAAATGGATTCTTCGGACAGAGATGTTTGGAGAAACTGCCTTTGCGATT
NM_013983.2       CTGCAAGTGTCCTGTGGGATACACCGGGGACAGGTGTCAG------------------CA
NM_013981.3       CTGCAAGTGTCCTGTGGGATACACCGGGGACAGGTGTCAG------------------CA
NM_013982.2       CTGCAAATGTCCAAATGGATTCTTCGGACAGAGATGTTTGGAGAAACTGCCTTTGCGATT
                  ******.*****:.: ****:*: ***. * **.*** :*                   :

HsCD00294880      GTTCGCAATGGTCAACTTCTCCAAGCACCTTGGATTTGAATTAAAGGAAGCCGAGGAGCT
NM_004883.2       GTACATGCCAGATCCTAAGCAAAAAGCCGAGG------------------------AGCT
NM_013983.2       GTTCGCAATGGTCAACTTCTCCAAGCACCTTGGATTTGAATTAAAGGAAGCCGAGGAGCT
NM_013981.3       GTTCGCAATGGTCAACTTCTCCAAAGCCGAGG------------------------AGCT
NM_013982.2       GTACATGCCAGATCCTAAGCAAAAGCACCTTGGATTTGAATTAAAGGAAGCCGAGGAGCT
                  **:*. .. .*: .. ::  ..**. .* : *                        ****

HsCD00294880      GTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTCGTGGGCAT
NM_004883.2       GTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTCGTGGGCAT
NM_013983.2       GTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTCGTGGGCAT
NM_013981.3       GTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTCGTGGGCAT
NM_013982.2       GTACCAGAAGAGGGTCCTGACCATCACGGGCATCTGCGTGGCTCTGCTGGTCGTGGGCAT
                  ************************************************************

HsCD00294880      CGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCACAACCACCT
NM_004883.2       CGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCACAACCACCT
NM_013983.2       CGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCACAACCACCT
NM_013981.3       CGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCACAACCACCT
NM_013982.2       CGTCTGTGTGGTGGCCTACTGCAAGACCAAAAAACAGCGGAAGCAGATGCACAACCACCT
                  ************************************************************

HsCD00294880      CCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCCAGCCACCC
NM_004883.2       CCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCCAGCCACCC
NM_013983.2       CCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCCAGCCACCC
NM_013981.3       CCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCCAGCCACCC
NM_013982.2       CCGGCAGAACATGTGCCCGGCCCATCAGAACCGGAGCTTGGCCAATGGGCCCAGCCACCC
                  ************************************************************

HsCD00294880      CCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTGCCAGCCAC
NM_004883.2       CCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTGCCAGCCAC
NM_013983.2       CCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTGCCAGCCAC
NM_013981.3       CCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTGCCAGCCAC
NM_013982.2       CCGGCTGGACCCAGAGGAGATCCAGATGGCAGATTATATTTCCAAGAACGTGCCAGCCAC
                  ************************************************************

HsCD00294880      AGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCCTGTTCTCC
NM_004883.2       AGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCCTGTTCTCC
NM_013983.2       AGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCCTGTTCTCC
NM_013981.3       AGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCCTGTTCTCC
NM_013982.2       AGACCATGTCATCAGGAGAGAAACTGAGACCACCTTCTCTGGGAGCCACTCCTGTTCTCC
                  ************************************************************

HsCD00294880      TTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGCCACACGTG
NM_004883.2       TTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGCCACACGTG
NM_013983.2       TTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGCCACACGTG
NM_013981.3       TTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGCCACACGTG
NM_013982.2       TTCTCACCACTGCTCCACAGCCACACCCACCTCCAGCCACAGACACGAGAGCCACACGTG
                  ************************************************************

HsCD00294880      GAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATGCTATCATC
NM_004883.2       GAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATGCTATCATC
NM_013983.2       GAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATGCTATCATC
NM_013981.3       GAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATGCTATCATC
NM_013982.2       GAGCCTGGAACGTTCTGAGAGCCTGACTTCTGACTCCCAGTCGGGGATCATGCTATCATC
                  ************************************************************

HsCD00294880      AGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGGCGGGCAGC
NM_004883.2       AGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGGCGGGCAGC
NM_013983.2       AGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGGCGGGCAGC
NM_013981.3       AGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGGCGGGCAGC
NM_013982.2       AGTGGGTACCAGCAAATGCAACAGCCCAGCATGTGTGGAGGCCCGGGCAAGGCGGGCAGC
                  ************************************************************

HsCD00294880      AGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGATTCCGTGGA
NM_004883.2       AGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGATTCCGTGGA
NM_013983.2       AGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGATTCCGTGGA
NM_013981.3       AGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGATTCCGTGGA
NM_013982.2       AGCCTACAACCTGGAGGAGCGGCGCAGGGCCACCGCGCCACCCTATCACGATTCCGTGGA
                  ************************************************************

HsCD00294880      CTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACGCCCGCGCG
NM_004883.2       CTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACGCCCGCGCG
NM_013983.2       CTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACGCCCGCGCG
NM_013981.3       CTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACGCCCGCGCG
NM_013982.2       CTCCCTTCGCGACTCCCCACACAGCGAGAGGTACGTGTCGGCCCTGACCACGCCCGCGCG
                  ************************************************************

HsCD00294880      CCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTCGAGATCAC
NM_004883.2       CCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTCGAGATCAC
NM_013983.2       CCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTCGAGATCAC
NM_013981.3       CCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTCGAGATCAC
NM_013982.2       CCTCTCGCCCGTGGACTTCCACTACTCGCTGGCCACGCAGGTGCCAACTTTCGAGATCAC
                  ************************************************************

HsCD00294880      GTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGTTACCGCCT
NM_004883.2       GTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGTTACCGCCT
NM_013983.2       GTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGTTACCGCCT
NM_013981.3       GTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGTTACCGCCT
NM_013982.2       GTCCCCCAACTCGGCGCACGCCGTGTCGCTGCCGCCGGCGGCGCCCATCAGTTACCGCCT
                  ************************************************************

HsCD00294880      GGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCCGGACCCGG
NM_004883.2       GGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCCGGACCCGG
NM_013983.2       GGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCCGGACCCGG
NM_013981.3       GGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCCGGACCCGG
NM_013982.2       GGCCGAGCAGCAGCCGTTACTGCGGCACCCGGCGCCCCCCGGCCCGGGACCCGGACCCGG
                  ************************************************************

HsCD00294880      GCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTATTACCCCGC
NM_004883.2       GCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTATTACCCCGC
NM_013983.2       GCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTATTACCCCGC
NM_013981.3       GCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTATTACCCCGC
NM_013982.2       GCCCGGGCCCGGGCCCGGCGCAGACATGCAGCGCAGCTATGACAGCTACTATTACCCCGC
                  ************************************************************

HsCD00294880      GGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGCAGCCTGCC
NM_004883.2       GGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGCAGCCTGCC
NM_013983.2       GGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGCAGCCTGCC
NM_013981.3       GGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGCAGCCTGCC
NM_013982.2       GGCGGGGCCCGGACCGCGGCGCGGGACCTGCGCGCTCGGCGGCAGCCTGGGCAGCCTGCC
                  ************************************************************

HsCD00294880      TGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAGTGCGCGCC
NM_004883.2       TGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAGTGCGCGCC
NM_013983.2       TGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAGTGCGCGCC
NM_013981.3       TGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAGTGCGCGCC
NM_013982.2       TGCCAGCCCCTTCCGCATCCCCGAGGACGACGAGTACGAGACCACGCAGGAGTGCGCGCC
                  ************************************************************

HsCD00294880      CCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCGGGGCCCCG
NM_004883.2       CCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCGGGGCCCCG
NM_013983.2       CCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCGGGGCCCCG
NM_013981.3       CCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCGGGGCCCCG
NM_013982.2       CCCGCCGCCGCCGCGGCCGCGCGCGCGCGGTGCGTCCCGCAGGACGTCGGCGGGGCCCCG
                  ************************************************************

HsCD00294880      GCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCGGCGAGGGA
NM_004883.2       GCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCGGCGAGGGA
NM_013983.2       GCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCGGCGAGGGA
NM_013981.3       GCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCGGCGAGGGA
NM_013982.2       GCGCTGGCGCCGCTCGCGCCTCAACGGGCTGGCGGCGCAGCGCGCACGGGCGGCGAGGGA
                  ************************************************************

HsCD00294880      CTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGACGACGACGC
NM_004883.2       CTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGACGACGACGC
NM_013983.2       CTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGACGACGACGC
NM_013981.3       CTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGACGACGACGC
NM_013982.2       CTCGCTGTCGCTGAGCAGCGGCTCGGGCGGCGGCTCAGCCTCGGCGTCGGACGACGACGC
                  ************************************************************

HsCD00294880      GGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTGCGTGGGGC
NM_004883.2       GGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTGCGTGGGGC
NM_013983.2       GGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTGCGTGGGGC
NM_013981.3       GGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTGCGTGGGGC
NM_013982.2       GGACGACGCGGACGGGGCGCTGGCGGCCGAGAGCACACCTTTCCTGGGCCTGCGTGGGGC
                  ************************************************************

HsCD00294880      GCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGCAGGACTTA
NM_004883.2       GCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGCAGGACTTA
NM_013983.2       GCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGCAGGACTTA
NM_013981.3       GCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGCAGGACTTA
NM_013982.2       GCACGACGCGCTGCGCTCGGACTCGCCGCCACTGTGCCCGGCGGCCGACAGCAGGACTTA
                  ************************************************************

HsCD00294880      CTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGGCCGCCCCC
NM_004883.2       CTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGGCCGCCCCC
NM_013983.2       CTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGGCCGCCCCC
NM_013981.3       CTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGGCCGCCCCC
NM_013982.2       CTACTCACTGGACAGCCACAGCACGCGGGCCAGCAGCAGACACAGCCGCGGGCCGCCCCC
                  ************************************************************

HsCD00294880      GCGGGCCAAGCAGGACTCGGCGCCACTCTAGGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_004883.2       GCGGGCCAAGCAGGACTCGGCGCCACTCTAG---------------------------
NM_013983.2       GCGGGCCAAGCAGGACTCGGCGCCACTCTAG---------------------------
NM_013981.3       GCGGGCCAAGCAGGACTCGGCGCCACTCTAG---------------------------
NM_013982.2       GCGGGCCAAGCAGGACTCGGCGCCACTCTAG---------------------------
                  *******************************                           

Pathways

NCI : ErbB receptor signaling network
NCI : ErbB2/ErbB3 signaling events
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in ERBB2 signaling
Reactome : GRB7 events in ERBB2 signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear signaling by ERBB4
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT activation
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway

Protein

SMART domain : EGF : Epidermal growth factor-like domain.
SMART domain : IG : Immunoglobulin
SMART domain : IGc2 : Immunoglobulin C-2 Type
UniProt : O14511
HPRD : 04821

Clone

Cloning Information : 481135
HIP Master Clone ID : 398863
IMAGE ID : 100066341
Original Clone ID : FLH481135.01X

Organism


TAX_ID : 9606
Species Specific ID: 9542

Genome

Chromosome : 5
Map Location : 5q23-q33
Ensembl : ENSG00000158458

Reagents

Labome : NRG2-antibody