DNASU Plasmid Repository • 480.965.5697 | Email

FGF2 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF2
Gene Name:  fibroblast growth factor 2 (basic)
Sequence             
Original Clone ID: FLH481166.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00294911

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 867nts         Open reading frame : 57 to 867
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCCTGGTGGGTGTGGGGGGTGGAGATGT
AGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTG
CAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAG
ACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCG
GACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCC
GGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGG
CCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCCGGCCGGG
CCCCGCAGGGACCATGGCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGG
CGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAA
CGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCCGGGAGAAGAG
CGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGG
AGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATG
TGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCG
GTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGG
ATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTA
GGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 935
Start on reference sequence 69
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF2
Symbol Nomenclature : FGF2
SYNONYM : BFGF; FGF-2; FGFB; HBGF-2
Designation : basic fibroblast growth factor bFGF|fibroblast growth factor 2|heparin-binding growth factor 2|prostatropin
Full Nomenclature : fibroblast growth factor 2 (basic)
GENEID : 2247
GI : 187960172
GenBank Accession : BC166646
HGNC : 3676
MIM : 134920
Vega : OTTHUMG00000039506
Target GenBank: NM_002006.4

 

Reference Sequence Alignment

  

HsCD00294911      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCCTGGTGGGTGTGGGGGGTGGAGATGT
NM_002006.4       ----------------------------------CTGGTGGGTGTGGGGGGTGGAGATGT
                                                    **************************

HsCD00294911      AGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTG
NM_002006.4       AGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTG
                  ************************************************************

HsCD00294911      CAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAG
NM_002006.4       CAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAG
                  ************************************************************

HsCD00294911      ACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCG
NM_002006.4       ACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCG
                  ************************************************************

HsCD00294911      GACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCC
NM_002006.4       GACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCC
                  ************************************************************

HsCD00294911      GGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGG
NM_002006.4       GGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGG
                  ************************************************************

HsCD00294911      CCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCCGGCCGGG
NM_002006.4       CCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCCGGCCGGG
                  ************************************************************

HsCD00294911      CCCCGCAGGGACCATGGCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGG
NM_002006.4       CCCCGCAGGGACCATGGCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGG
                  ************************************************************

HsCD00294911      CGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAA
NM_002006.4       CGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAA
                  ************************************************************

HsCD00294911      CGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCCGGGAGAAGAG
NM_002006.4       CGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCCGGGAGAAGAG
                  ************************************************************

HsCD00294911      CGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGG
NM_002006.4       CGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGG
                  ************************************************************

HsCD00294911      AGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATG
NM_002006.4       AGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATG
                  ************************************************************

HsCD00294911      TGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCG
NM_002006.4       TGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCG
                  ************************************************************

HsCD00294911      GTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGG
NM_002006.4       GTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGG
                  ************************************************************

HsCD00294911      ATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTA
NM_002006.4       ATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTG
                  ***********************************************************.

HsCD00294911      GGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_002006.4       A---------------------------
                  .                           

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : FGF signaling pathway
NCI : Glypican 1 network
NCI : Integrins in angiogenesis
NCI : Syndecan-4-mediated signaling events
Reactome : Activated point mutants of FGFR2
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Extracellular matrix organization
Reactome : FGFR ligand binding and activation
Reactome : FGFR1 ligand binding and activation
Reactome : FGFR1b ligand binding and activation
Reactome : FGFR1c ligand binding and activation
Reactome : FGFR2 ligand binding and activation
Reactome : FGFR2c ligand binding and activation
Reactome : FGFR3 ligand binding and activation
Reactome : FGFR3c ligand binding and activation
Reactome : FGFR4 ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Non-integrin membrane-ECM interactions
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : POU5F1 (OCT4), SOX2, NANOG activate genes related to proliferation
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by FGFR2 mutants
Reactome : Signaling by FGFR3 mutants
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by activated point mutants of FGFR1
Reactome : Signaling by activated point mutants of FGFR3
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Syndecan interactions
Reactome : Transcriptional regulation of pluripotent stem cells
WikiPathway : Angiogenesis
WikiPathway : Endochondral Ossification
WikiPathway : Lymphocyte TarBase
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Neural Crest Differentiation
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Squamous cell TarBase

Protein

UniProt : P09038
HPRD : 00622

Clone

Cloning Information : 481166
HIP Master Clone ID : 398894
IMAGE ID : 100066372
Original Clone ID : FLH481166.01X

Organism


TAX_ID : 9606
Species Specific ID: 2247

Genome

Chromosome : 4
Map Location : 4q26
Ensembl : ENSG00000138685

Reagents

Labome : FGF-2-antibody