DNASU Plasmid Repository • 480.965.5697 | Email

B3GALT6 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  B3GALT6
Gene Name:  UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Sequence             
Original Clone ID: FLH481452.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00295197

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 990nts         Open reading frame : 35 to 990
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAGCTGCTGCGGCGGGCGTGGCG
GCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCTGTGCGGGGCGGCGCTGCTCTACCT
GGCGCGCTGCGCGGCCGAGCCCGGGGACCCCAGGGCGATGTCGGGCCGCAGCCCGCCTCC
CCCCGCGCCCGCGCGCGCCGCCGCCTTCCTGGCAGTGCTGGTGGCCAGCGCGCCCCGCGC
CGCCGAGCGCCGCAGCGTGATCCGCAGCACGTGGCTTGCGCGGCGCGGGGCCCCGGGCGA
CGTGTGGGCGCGCTTTGCCGTGGGCACGGCCGGCCTGGGCGCCGAGGAGCGGCGCGCCCT
GGAGCGGGAGCAGGCGCGGCACGGGGACCTGCTGCTGCTGCCCGCGCTGCGCGACGCCTA
CGAAAACCTCACGGCCAAGGTGCTGGCCATGCTGGCCTGGCTGGACGAGCACGTGGCCTT
CGAGTTCGTGCTCAAGGCGGACGACGACTCCTTCGCGCGGCTGGACGCGCTGCTGGCCGA
GCTGCGCGCCCGCGAGCCCGCGCGCCGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCG
CGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGAGGCCGCCTGGCAACTCTGCGACTACTA
CCTGCCCTACGCGCTGGGCGGCGGCTACGTGCTCTCGGCCGACCTGGTGCACTACCTGCG
CCTCAGCCGCGACTACCTGCGCGCCTGGCACAGCGAGGACGTGTCTCTGGGCGCCTGGCT
GGCGCCGGTGGACGTCCAGCGGGAGCACGACCCGCGCTTCGACACCGAATACCGGTCCCG
CGGCTGCAGCAACCAGTACCTGGTGACGCACAAGCAGAGCCTGGAGGACATGCTGGAGAA
GCACGCGACGCTGGCGCGCGAGGGCCGCCTGTGCAAGCGCGAGGTGCAGCTGCGCCTGTC
CTACGTGTACGACTGGTCCGCGCCGCCCTCGCAGTGCTGCCAGAGAAGGGAGGGCATCCC
CTAGGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1020
Start on reference sequence 31
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : B3GALT6
Symbol Nomenclature : B3GALT6
SYNONYM : EDSP2; SEMDJL1; beta3GalT6
Designation : GAG GalTII|UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 6|beta-1,3-GalTase 6|beta-1,3-galactosyltransferase 6|beta3Gal-T6|galactosyltransferase II|galactosylxylosylprotein 3-beta-galactosyltransferase
Full Nomenclature : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
GENEID : 126792
GI : 182888216
GenBank Accession : BC160034
HGNC : 17978
MIM : 615291
Vega : OTTHUMG00000001813
Target GenBank: NM_080605.3

 

Reference Sequence Alignment

  

HsCD00295197      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAGCTGCTGCGGCGGGCGTGGCG
NM_080605.3       ----------------------------------ATGAAGCTGCTGCGGCGGGCGTGGCG
                                                    **************************

HsCD00295197      GCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCTGTGCGGGGCGGCGCTGCTCTACCT
NM_080605.3       GCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCTGTGCGGGGCGGCGCTGCTCTACCT
                  ************************************************************

HsCD00295197      GGCGCGCTGCGCGGCCGAGCCCGGGGACCCCAGGGCGATGTCGGGCCGCAGCCCGCCTCC
NM_080605.3       GGCGCGCTGCGCGGCCGAGCCCGGGGACCCCAGGGCGATGTCGGGCCGCAGCCCGCCTCC
                  ************************************************************

HsCD00295197      CCCCGCGCCCGCGCGCGCCGCCGCCTTCCTGGCAGTGCTGGTGGCCAGCGCGCCCCGCGC
NM_080605.3       CCCCGCGCCCGCGCGCGCCGCCGCCTTCCTGGCAGTGCTGGTGGCCAGCGCGCCCCGCGC
                  ************************************************************

HsCD00295197      CGCCGAGCGCCGCAGCGTGATCCGCAGCACGTGGCTTGCGCGGCGCGGGGCCCCGGGCGA
NM_080605.3       CGCCGAGCGCCGCAGCGTGATCCGCAGCACGTGGCTTGCGCGGCGCGGGGCCCCGGGCGA
                  ************************************************************

HsCD00295197      CGTGTGGGCGCGCTTTGCCGTGGGCACGGCCGGCCTGGGCGCCGAGGAGCGGCGCGCCCT
NM_080605.3       CGTGTGGGCGCGCTTTGCCGTGGGCACGGCCGGCCTGGGCGCCGAGGAGCGGCGCGCCCT
                  ************************************************************

HsCD00295197      GGAGCGGGAGCAGGCGCGGCACGGGGACCTGCTGCTGCTGCCCGCGCTGCGCGACGCCTA
NM_080605.3       GGAGCGGGAGCAGGCGCGGCACGGGGACCTGCTGCTGCTGCCCGCGCTGCGCGACGCCTA
                  ************************************************************

HsCD00295197      CGAAAACCTCACGGCCAAGGTGCTGGCCATGCTGGCCTGGCTGGACGAGCACGTGGCCTT
NM_080605.3       CGAAAACCTCACGGCCAAGGTGCTGGCCATGCTGGCCTGGCTGGACGAGCACGTGGCCTT
                  ************************************************************

HsCD00295197      CGAGTTCGTGCTCAAGGCGGACGACGACTCCTTCGCGCGGCTGGACGCGCTGCTGGCCGA
NM_080605.3       CGAGTTCGTGCTCAAGGCGGACGACGACTCCTTCGCGCGGCTGGACGCGCTGCTGGCCGA
                  ************************************************************

HsCD00295197      GCTGCGCGCCCGCGAGCCCGCGCGCCGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCG
NM_080605.3       GCTGCGCGCCCGCGAGCCCGCGCGCCGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCG
                  ************************************************************

HsCD00295197      CGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGAGGCCGCCTGGCAACTCTGCGACTACTA
NM_080605.3       CGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGAGGCCGCCTGGCAACTCTGCGACTACTA
                  ************************************************************

HsCD00295197      CCTGCCCTACGCGCTGGGCGGCGGCTACGTGCTCTCGGCCGACCTGGTGCACTACCTGCG
NM_080605.3       CCTGCCCTACGCGCTGGGCGGCGGCTACGTGCTCTCGGCCGACCTGGTGCACTACCTGCG
                  ************************************************************

HsCD00295197      CCTCAGCCGCGACTACCTGCGCGCCTGGCACAGCGAGGACGTGTCTCTGGGCGCCTGGCT
NM_080605.3       CCTCAGCCGCGACTACCTGCGCGCCTGGCACAGCGAGGACGTGTCTCTGGGCGCCTGGCT
                  ************************************************************

HsCD00295197      GGCGCCGGTGGACGTCCAGCGGGAGCACGACCCGCGCTTCGACACCGAATACCGGTCCCG
NM_080605.3       GGCGCCGGTGGACGTCCAGCGGGAGCACGACCCGCGCTTCGACACCGAATACCGGTCCCG
                  ************************************************************

HsCD00295197      CGGCTGCAGCAACCAGTACCTGGTGACGCACAAGCAGAGCCTGGAGGACATGCTGGAGAA
NM_080605.3       CGGCTGCAGCAACCAGTACCTGGTGACGCACAAGCAGAGCCTGGAGGACATGCTGGAGAA
                  ************************************************************

HsCD00295197      GCACGCGACGCTGGCGCGCGAGGGCCGCCTGTGCAAGCGCGAGGTGCAGCTGCGCCTGTC
NM_080605.3       GCACGCGACGCTGGCGCGCGAGGGCCGCCTGTGCAAGCGCGAGGTGCAGCTGCGCCTGTC
                  ************************************************************

HsCD00295197      CTACGTGTACGACTGGTCCGCGCCGCCCTCGCAGTGCTGCCAGAGAAGGGAGGGCATCCC
NM_080605.3       CTACGTGTACGACTGGTCCGCGCCGCCCTCGCAGTGCTGCCAGAGAAGGGAGGGCATCCC
                  ************************************************************

HsCD00295197      CTAGGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_080605.3       CTGA---------------------------
                  **..                           

Pathways

Reactome : A tetrasaccharide linker sequence is required for GAG synthesis
Reactome : Chondroitin sulfate/dermatan sulfate metabolism
Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : Heparan sulfate/heparin (HS-GAG) metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora

Protein

UniProt : Q96L58
HPRD : 12509

Clone

Cloning Information : 481452
HIP Master Clone ID : 399180
IMAGE ID : 100063970
Original Clone ID : FLH481452.01X

Organism


TAX_ID : 9606
Species Specific ID: 126792

Genome

Chromosome : 1
Map Location : 1p36.33
Ensembl : ENSG00000176022

Reagents

Labome : B3GALT6-antibody