DNASU Plasmid Repository • 480.965.5697 | Email

DUSP4 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DUSP4
Gene Name:  dual specificity phosphatase 4
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH482044.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00295702

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1182nts         Open reading frame : 23 to 1182
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGGTGACGATGGAGGAGCTGCGGGAGATGGACTGCAG
TGTGCTCAAAAGGCTGATGAACCGGGACGAGAATGGCGGCGGCGCGGGCGGCAGCGGCAG
CCACGGCACCCTGGGGCTGCCGAGCGGCGGCAAGTGCCTGCTGCTGGACTGCAGACCGTT
CCTGGCGCACAGCGCGGGCTACATCCTAGGTTCGGTCAACGTGCGCTGTAACACCATCGT
GCGGCGGCGGGCTAAGGGCTCCGTGAGCCTGGAGCAGATCCTGCCCGCCGAGGAGGAGGT
ACGCGCCCGCTTGCGCTCCGGCCTCTACTCGGCGGTCATCGTCTACGACGAGCGCAGCCC
GCGCGCCGAGAGCCTCCGCGAGGACAGCACCGTGTCGCTGGTGGTGCAGGCGCTGCGCCG
CAACGCCGAGCGCACCGACATCTGCCTGCTCAAAGGCGGCTATGAGAGGTTTTCCTCCGA
GTACCCAGAATTCTGTTCTAAAACCAAGGCCCTGGCAGCCATCCCACCCCCGGTTCCCCC
CAGCGCCACAGAGCCCTTGGACCTGGGCTGCAGCTCCTGTGGGACCCCACTACACGACCA
GGGGGGTCCTGTGGAGATCCTTCCCTTCCTCTACCTCGGCAGTGCCTACCATGCTGCCCG
GAGAGACATGCTGGACGCCCTGGGCATCACGGCTCTGTTGAATGTCTCCTCGGACTGCCC
AAACCACTTTGAAGGACACTATCAGTACAAGTGCATCCCAGTGGAAGATAACCACAAGGC
CGACATCAGCTCCTGGTTCATGGAAGCCATAGAGTACATCGATGCCGTGAAGGACTGCCG
TGGGCGCGTGCTGGTGCACTGCCAGGCGGGCATCTCGCGGTCGGCCACCATCTGCCTGGC
CTACCTGATGATGAAGAAACGGGTGAGGCTGGAGGAGGCCTTCGAGTTCGTTAAGCAGCG
CCGCAGCATCATCTCGCCCAACTTCAGCTTCATGGGGCAGCTGCTGCAGTTCGAGTCCCA
GGTGCTGGCCACGTCCTGTGCTGCGGAGGCTGCTAGCCCCTCGGGACCCCTGCGGGAGCG
GGGCAAGACCCCCGCCACCCCCACCTCGCAGTTCGTCTTCAGCTTTCCGGTCTCCGTGGG
CGTGCACTCGGCCCCCAGCAGCCTGCCCTACCTGCACAGCCCCATCACCACCTCTCCCAG
CTGTTGGATCCACCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1343
Start on reference sequence 159
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DUSP4
Symbol Nomenclature : DUSP4
SYNONYM : HVH2; MKP-2; MKP2; TYP
Designation : MAP kinase phosphatase 2|VH1 homologous phosphatase 2|dual specificity protein phosphatase 4|dual specificity protein phosphatase hVH2|mitogen-activated protein kinase phosphatase 2|serine/threonine specific protein phosphatase
Full Nomenclature : dual specificity phosphatase 4
GENEID : 1846
GI : 190689388
GenBank Accession : EU831550
HGNC : 3070
MIM : 602747
Vega : OTTHUMG00000133395
Target GenBank: BC002671.2

 

Reference Sequence Alignment

  

HsCD00295702      GTACAAAAAAGCAGGCTCCACCATGGTGACGATGGAGGAGCTGCGGGAGATGGACTGCAG
NM_001394.6       ----------------------ATGGTGACGATGGAGGAGCTGCGGGAGATGGACTGCAG
                                        **************************************

HsCD00295702      TGTGCTCAAAAGGCTGATGAACCGGGACGAGAATGGCGGCGGCGCGGGCGGCAGCGGCAG
NM_001394.6       TGTGCTCAAAAGGCTGATGAACCGGGACGAGAATGGCGGCGGCGCGGGCGGCAGCGGCAG
                  ************************************************************

HsCD00295702      CCACGGCACCCTGGGGCTGCCGAGCGGCGGCAAGTGCCTGCTGCTGGACTGCAGACCGTT
NM_001394.6       CCACGGCACCCTGGGGCTGCCGAGCGGCGGCAAGTGCCTGCTGCTGGACTGCAGACCGTT
                  ************************************************************

HsCD00295702      CCTGGCGCACAGCGCGGGCTACATCCTAGGTTCGGTCAACGTGCGCTGTAACACCATCGT
NM_001394.6       CCTGGCGCACAGCGCGGGCTACATCCTAGGTTCGGTCAACGTGCGCTGTAACACCATCGT
                  ************************************************************

HsCD00295702      GCGGCGGCGGGCTAAGGGCTCCGTGAGCCTGGAGCAGATCCTGCCCGCCGAGGAGGAGGT
NM_001394.6       GCGGCGGCGGGCTAAGGGCTCCGTGAGCCTGGAGCAGATCCTGCCCGCCGAGGAGGAGGT
                  ************************************************************

HsCD00295702      ACGCGCCCGCTTGCGCTCCGGCCTCTACTCGGCGGTCATCGTCTACGACGAGCGCAGCCC
NM_001394.6       ACGCGCCCGCTTGCGCTCCGGCCTCTACTCGGCGGTCATCGTCTACGACGAGCGCAGCCC
                  ************************************************************

HsCD00295702      GCGCGCCGAGAGCCTCCGCGAGGACAGCACCGTGTCGCTGGTGGTGCAGGCGCTGCGCCG
NM_001394.6       GCGCGCCGAGAGCCTCCGCGAGGACAGCACCGTGTCGCTGGTGGTGCAGGCGCTGCGCCG
                  ************************************************************

HsCD00295702      CAACGCCGAGCGCACCGACATCTGCCTGCTCAAAGGCGGCTATGAGAGGTTTTCCTCCGA
NM_001394.6       CAACGCCGAGCGCACCGACATCTGCCTGCTCAAAGGCGGCTATGAGAGGTTTTCCTCCGA
                  ************************************************************

HsCD00295702      GTACCCAGAATTCTGTTCTAAAACCAAGGCCCTGGCAGCCATCCCACCCCCGGTTCCCCC
NM_001394.6       GTACCCAGAATTCTGTTCTAAAACCAAGGCCCTGGCAGCCATCCCACCCCCGGTTCCCCC
                  ************************************************************

HsCD00295702      CAGCGCCACAGAGCCCTTGGACCTGGGCTGCAGCTCCTGTGGGACCCCACTACACGACCA
NM_001394.6       CAGTGCCACAGAGCCCTTGGACCTGGGCTGCAGCTCCTGTGGGACCCCACTACACGACCA
                  *** ********************************************************

HsCD00295702      GGGGGGTCCTGTGGAGATCCTTCCCTTCCTCTACCTCGGCAGTGCCTACCATGCTGCCCG
NM_001394.6       GGGGGGTCCTGTGGAGATCCTTCCCTTCCTCTACCTCGGCAGTGCCTACCATGCTGCCCG
                  ************************************************************

HsCD00295702      GAGAGACATGCTGGACGCCCTGGGCATCACGGCTCTGTTGAATGTCTCCTCGGACTGCCC
NM_001394.6       GAGAGACATGCTGGACGCCCTGGGCATCACGGCTCTGTTGAATGTCTCCTCGGACTGCCC
                  ************************************************************

HsCD00295702      AAACCACTTTGAAGGACACTATCAGTACAAGTGCATCCCAGTGGAAGATAACCACAAGGC
NM_001394.6       AAACCACTTTGAAGGACACTATCAGTACAAGTGCATCCCAGTGGAAGATAACCACAAGGC
                  ************************************************************

HsCD00295702      CGACATCAGCTCCTGGTTCATGGAAGCCATAGAGTACATCGATGCCGTGAAGGACTGCCG
NM_001394.6       CGACATCAGCTCCTGGTTCATGGAAGCCATAGAGTACATCGATGCCGTGAAGGACTGCCG
                  ************************************************************

HsCD00295702      TGGGCGCGTGCTGGTGCACTGCCAGGCGGGCATCTCGCGGTCGGCCACCATCTGCCTGGC
NM_001394.6       TGGGCGCGTGCTGGTGCACTGCCAGGCGGGCATCTCGCGGTCGGCCACCATCTGCCTGGC
                  ************************************************************

HsCD00295702      CTACCTGATGATGAAGAAACGGGTGAGGCTGGAGGAGGCCTTCGAGTTCGTTAAGCAGCG
NM_001394.6       CTACCTGATGATGAAGAAACGGGTGAGGCTGGAGGAGGCCTTCGAGTTCGTTAAGCAGCG
                  ************************************************************

HsCD00295702      CCGCAGCATCATCTCGCCCAACTTCAGCTTCATGGGGCAGCTGCTGCAGTTCGAGTCCCA
NM_001394.6       CCGCAGCATCATCTCGCCCAACTTCAGCTTCATGGGGCAGCTGCTGCAGTTCGAGTCCCA
                  ************************************************************

HsCD00295702      GGTGCTGGCCACGTCCTGTGCTGCGGAGGCTGCTAGCCCCTCGGGACCCCTGCGGGAGCG
NM_001394.6       GGTGCTGGCCACGTCCTGTGCTGCGGAGGCTGCTAGCCCCTCGGGACCCCTGCGGGAGCG
                  ************************************************************

HsCD00295702      GGGCAAGACCCCCGCCACCCCCACCTCGCAGTTCGTCTTCAGCTTTCCGGTCTCCGTGGG
NM_001394.6       GGGCAAGACCCCCGCCACCCCCACCTCGCAGTTCGTCTTCAGCTTTCCGGTCTCCGTGGG
                  ************************************************************

HsCD00295702      CGTGCACTCGGCCCCCAGCAGCCTGCCCTACCTGCACAGCCCCATCACCACCTCTCCCAG
NM_001394.6       CGTGCACTCGGCCCCCAGCAGCCTGCCCTACCTGCACAGCCCCATCACCACCTCTCCCAG
                  ************************************************************

HsCD00295702      CTGTTGGATCCACCCAGCTTTCTTGTAC
NM_001394.6       CTGTTAG---------------------
                  *****.*                     

Pathways

Reactome : Activated TLR4 signalling
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : MAPK signaling pathway

Clone

Cloning Information : 482044
HIP Master Clone ID : 399772
IMAGE ID : 100066579
Original Clone ID : FLH482044.01L

Organism


TAX_ID : 9606
Species Specific ID: 1846

Genome

Chromosome : 8
Map Location : 8p12-p11
Ensembl : ENSG00000120875

Reagents

Labome : DUSP4-antibody