DNASU Plasmid Repository • 480.965.5697 | Email

MYD88 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MYD88
Gene Name:  myeloid differentiation primary response 88
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH482537.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00296195

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 912nts         Open reading frame : 23 to 912
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTGCGGCCCC
GGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCT
GTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGA
GATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAG
GCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCT
TACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCCAGCATTGAGGAGGATTG
CCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGC
TGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTGATGACCC
CCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGACATCCA
GTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGT
GTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGA
AAAGAGGTTGGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATGGTGGTGGTTGTCTCTGA
TGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCC
AGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCC
CAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTT
CTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGGATCCACCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 934
Start on reference sequence 23
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MYD88
Symbol Nomenclature : MYD88
SYNONYM : MYD88D
Designation : myeloid differentiation primary response gene (88)|myeloid differentiation primary response protein MyD88
Full Nomenclature : myeloid differentiation primary response 88
GENEID : 4615
GI : 190689864
GenBank Accession : EU832045
HGNC : 7562
MIM : 602170
Vega : OTTHUMG00000131083
Target GenBank: EU832045.1

 

Reference Sequence Alignment

  

HsCD00296195        -----------------GTACAAAAAAGCAGGCTCCACCATGGCTGCAGGAGGTCCCGGC
NM_001172567.1      ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
NM_002468.4         ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
                                       * ..:..** *    **.***********************

HsCD00296195        GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
NM_001172567.1      GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
NM_002468.4         GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
                    ************************************************************

HsCD00296195        CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
NM_001172567.1      CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
NM_002468.4         CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
                    ************************************************************

HsCD00296195        ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
NM_001172567.1      ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
NM_002468.4         ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
                    ************************************************************

HsCD00296195        GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
NM_001172567.1      GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
NM_002468.4         GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
                    ************************************************************

HsCD00296195        CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
NM_001172567.1      CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
NM_002468.4         CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
                    ************************************************************

HsCD00296195        AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
NM_001172567.1      AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
NM_002468.4         AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
                    ************************************************************

HsCD00296195        CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
NM_001172567.1      CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
NM_002468.4         CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
                    ************************************************************

HsCD00296195        ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
NM_001172567.1      ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
NM_002468.4         ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
                    ************************************************************

HsCD00296195        TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
NM_001172567.1      TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
NM_002468.4         TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
                    ************************************************************

HsCD00296195        CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
NM_001172567.1      CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
NM_002468.4         CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
                    ************************************************************

HsCD00296195        GCTAGTGAGCTCATCGAAAAGAGGTTGGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATG
NM_001172567.1      GCTAGTGAGCTCATCGAAAAGAGGTTGGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATG
NM_002468.4         GCTAGTGAGCTCATCGAAAAGAG------------------------GTGCCGCCGGATG
                    ***********************                        *************

HsCD00296195        GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
NM_001172567.1      GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
NM_002468.4         GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
                    ************************************************************

HsCD00296195        GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
NM_001172567.1      GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
NM_002468.4         GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
                    ************************************************************

HsCD00296195        ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
NM_001172567.1      ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
NM_002468.4         ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
                    ************************************************************

HsCD00296195        TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGGATCCAC
NM_001172567.1      TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA------
NM_002468.4         TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA------
                    *****************************************************.      

HsCD00296195        CCAGCTTTCTTGTAC
NM_001172567.1      ---------------
NM_002468.4         ---------------
                                   

Pathways

NCI : Endogenous TLR signaling
NCI : IL1-mediated signaling events
NCI : p75(NTR)-mediated signaling
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DEx/H-box helicases activate type I IFN and inflammatory cytokines production
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : IL-1 signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : DEATH : DEATH domain, found in proteins involved in cell death (apoptosis).
SMART domain : TIR : Toll - interleukin 1 - resistance
UniProt : B4DQ72
UniProt : Q99836
UniProt : B4DQ60
HPRD : 03703

Clone

Cloning Information : 482537
HIP Master Clone ID : 400265
IMAGE ID : 100067074
Original Clone ID : FLH482537.01L

Organism


TAX_ID : 9606
Species Specific ID: 4615

Genome

Chromosome : 3
Map Location : 3p22
Ensembl : ENSG00000172936

Reagents

Labome : MYD88-antibody