DNASU Plasmid Repository • 480.965.5697 | Email

PPP1CC (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP1CC
Gene Name:  protein phosphatase 1, catalytic subunit, gamma isozyme
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH482588.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00296246

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 969nts         Open reading frame : 23 to 969
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGGCGGATTTAGATAAACTCAACATCGACAGCATTAT
CCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAA
TGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACT
AGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCT
GCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTA
TGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAA
ATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAAT
TTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCAC
AGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCA
TGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAAC
TGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGT
CTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGC
AAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGA
TGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTG
CGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTT
TCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCC
AAGGGGTATGATCACAAAGCAAGCAAAGAAATGGATCCACCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1136
Start on reference sequence 165
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP1CC
Symbol Nomenclature : PPP1CC
SYNONYM : PP-1G; PP1C; PPP1G
Designation : protein phosphatase 1, catalytic subunit, gamma isoform|protein phosphatase 1C catalytic subunit|serine/threonine phosphatase 1 gamma|serine/threonine-protein phosphatase PP1-gamma catalytic subunit
Full Nomenclature : protein phosphatase 1, catalytic subunit, gamma isozyme
GENEID : 5501
GI : 190689946
GenBank Accession : EU832086
HGNC : 9283
MIM : 176914
Vega : OTTHUMG00000169531
Target GenBank: BC014073.2

 

Reference Sequence Alignment

  

HsCD00296246        GTACAAAAAAGCAGGCTCCACCATGGCGGATTTAGATAAACTCAACATCGACAGCATTAT
NM_002710.3         ----------------------ATGGCGGATTTAGATAAACTCAACATCGACAGCATTAT
NM_002708.3         ----------------------ATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCAT
NM_001244974.1      ----------------------ATGGCGGATTTAGATAAACTCAACATCGACAGCATTAT
                                          *** * ** : .** **.******.* ***:  ** **

HsCD00296246        CCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAA
NM_002710.3         CCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAA
NM_002708.3         CGGGCGCCTGCTGGAAGTGCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAA
NM_001244974.1      CCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAA
                    * ..** ************...** ** ..****** ********.***** ...*****

HsCD00296246        TGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACT
NM_002710.3         TGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACT
NM_002708.3         CGAGATCCGCGGTCTGTGCCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCT
NM_001244974.1      TGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACT
                     **.***.*.**:****** *.**.** ** **.** ***** ** ***** ** **:**

HsCD00296246        AGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCT
NM_002710.3         AGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCT
NM_002708.3         GGAGCTGGAGGCACCCCTCAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCT
NM_001244974.1      AGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCT
                    .**.** **.*****.*****.**.** ********.** **.**.***** **  * **

HsCD00296246        GCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTA
NM_002710.3         GCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTA
NM_002708.3         GCGACTATTTGAGTATGGCGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTA
NM_001244974.1      GCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTA
                    ******:******** ** ********:**.**.*********** ***** ********

HsCD00296246        TGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAA
NM_002710.3         TGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAA
NM_002708.3         TGTGGACAGGGGCAAGCAGTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAA
NM_001244974.1      TGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAA
                    ************.********.******** ********  *.******** **.**.**

HsCD00296246        ATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAAT
NM_002710.3         ATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAAT
NM_002708.3         GTACCCCGAGAACTTCTTCCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCAT
NM_001244974.1      ATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAAT
                    .** ** ***** ** ** ** ***.*:******** **.***************.*.**

HsCD00296246        TTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCAC
NM_002710.3         TTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCAC
NM_002708.3         CTATGGTTTCTACGATGAGTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCAC
NM_001244974.1      TTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCAC
                     *****:** ** *****.** **.***.*.******** *****.******** *****

HsCD00296246        AGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCA
NM_002710.3         AGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCA
NM_002708.3         TGACTGCTTCAACTGCCTGCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCA
NM_001244974.1      AGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCA
                    :***** ** *****  *.** **.**.*****.***** **.*****.******** **

HsCD00296246        TGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAAC
NM_002710.3         TGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAAC
NM_002708.3         CGGAGGCCTGTCCCCGGACCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCAC
NM_001244974.1      TGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAAC
                     *****  *.**.**.** ** **.********************.** *****.**.**

HsCD00296246        TGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGT
NM_002710.3         TGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGT
NM_002708.3         AGATGTGCCTGACCAGGGCCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGT
NM_001244974.1      TGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGT
                    :*****.**:** **.** ** ** ***** **  ************* ** **.** **

HsCD00296246        CTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGC
NM_002710.3         CTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGC
NM_002708.3         GCAGGGCTGGGGCGAGAACGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGC
NM_001244974.1      CTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGC
                      :.******** **.** ***.*:**.** ** ** **.*****:**.**.***** **

HsCD00296246        AAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGA
NM_002710.3         AAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGA
NM_002708.3         CAAGTTCCTCCACAAGCACGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGA
NM_001244974.1      AAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGA
                    .**.** ***** ***** ** ***** ** **.** .****.** ********:*****

HsCD00296246        TGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTG
NM_002710.3         TGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTG
NM_002708.3         CGGCTACGAGTTCTTTGCCAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTG
NM_001244974.1      TGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTG
                     **.** **.** *****.***.***** **** **:** ** **:** ***** ** **

HsCD00296246        CGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTT
NM_002710.3         CGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTT
NM_002708.3         TGGCGAGTTTGACAATGCTGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTT
NM_001244974.1      CGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTT
                     **.**************:** ***************** **.**.**.***** *****

HsCD00296246        TCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCC
NM_002710.3         TCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCC
NM_002708.3         CCAGATCCTCAAGCCCGCCGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAA
NM_001244974.1      TCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCC
                     *****  *.***** **.** **.** ***  .**  .*. *...   . :.  *  ..

HsCD00296246        AAGGGGTATGATCACAAAGCAAGCAAAGAAATGGATCCACCCAGCTTTCTTGTAC-----
NM_002710.3         AAGGGGTATGATCACAAAGCAAGCAAAGAAATAG--------------------------
NM_002708.3         CCCTGGAGGCCGACCCATCACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAG-----
NM_001244974.1      AAGGGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATAC
                    ..  * :.    .  ..: ... *. . .   .                           

HsCD00296246        ----------------
NM_002710.3         ----------------
NM_002708.3         ----------------
NM_001244974.1      TGTTCTATACGAGTGA
                                    

Pathways

NCI : Aurora B signaling
NCI : Insulin-mediated glucose transport
Panther : Dopamine receptor mediated signaling pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Hormone-sensitive lipase (HSL)-mediated triacylglycerol hydrolysis
Reactome : Lipid digestion, mobilization, and transport
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : M Phase
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer

Clone

Cloning Information : 482588
HIP Master Clone ID : 400316
IMAGE ID : 100067115
Original Clone ID : FLH482588.01L

Organism


TAX_ID : 9606
Species Specific ID: 5501

Genome

Chromosome : 12
Map Location : 12q24.1-q24.2
Ensembl : ENSG00000186298

Reagents

Labome : PPP1CC-antibody