DNASU Plasmid Repository • 480.965.5697 | Email

YWHAB (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAB
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH482743.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00296401

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 738nts         Open reading frame : 23 to 738
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAA
ACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGA
ACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGT
GGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAG
GAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCA
GGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACA
ACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGA
AGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGA
AGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGC
ACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCT
GGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTA
TAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGA
AAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTGGATCCACCCAGCTTTCTT
GTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 922
Start on reference sequence 182
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGAATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAB
Symbol Nomenclature : YWHAB
SYNONYM : GW128; HEL-S-1; HS1; KCIP-1; YWHAA
Designation : 14-3-3 alpha|14-3-3 protein beta/alpha|brain protein 14-3-3, beta isoform|epididymis secretory protein Li 1|protein 1054|protein kinase C inhibitor protein 1|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta
GENEID : 7529
Locus Tag : RP1-148E22.1
GI : 190690258
GenBank Accession : EU832419
HGNC : 12849
MIM : 601289
Vega : OTTHUMG00000032549
Target GenBank: BC001359.2

 

Reference Sequence Alignment

  

HsCD00296401      GTACAAAAAAGCAGGCTCCACCATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAA
NM_003404.4       ----------------------ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAA
NM_139323.3       ----------------------ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAA
                                        **************************************

HsCD00296401      ACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGA
NM_003404.4       ACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGA
NM_139323.3       ACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGA
                  ************************************************************

HsCD00296401      ACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGT
NM_003404.4       ACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGT
NM_139323.3       ACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGT
                  ************************************************************

HsCD00296401      GGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAG
NM_003404.4       GGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAG
NM_139323.3       GGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAG
                  ************************************************************

HsCD00296401      GAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCA
NM_003404.4       GAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCA
NM_139323.3       GAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCA
                  ************************************************************

HsCD00296401      GGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACA
NM_003404.4       GGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACA
NM_139323.3       GGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACA
                  ************************************************************

HsCD00296401      ACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGA
NM_003404.4       ACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGA
NM_139323.3       ACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGA
                  ************************************************************

HsCD00296401      AGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGA
NM_003404.4       AGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGA
NM_139323.3       AGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGA
                  ************************************************************

HsCD00296401      AGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGC
NM_003404.4       AGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGC
NM_139323.3       AGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGC
                  ************************************************************

HsCD00296401      ACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCT
NM_003404.4       ACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCT
NM_139323.3       ACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCT
                  ************************************************************

HsCD00296401      GGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTA
NM_003404.4       GGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTA
NM_139323.3       GGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTA
                  ************************************************************

HsCD00296401      TAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGA
NM_003404.4       TAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGA
NM_139323.3       TAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGA
                  ************************************************************

HsCD00296401      AAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTGGATCCACCCAGCTTTCTT
NM_003404.4       AAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTAA-----------------
NM_139323.3       AAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTAA-----------------
                  *****************************************..                 

HsCD00296401      GTAC
NM_003404.4       ----
NM_139323.3       ----
                      

Pathways

NCI : ATM pathway
NCI : ATR signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : ARMS-mediated activation
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : Axon guidance
Reactome : Butyrate Response Factor 1 (BRF1) destabilizes mRNA
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Intrinsic Pathway for Apoptosis
Reactome : MEK activation
Reactome : Membrane Trafficking
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Rap1 signalling
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Hippo
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : Tristetraprolin (TTP) destabilizes mRNA
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P31946
HPRD : 03184

Clone

Cloning Information : 482743
HIP Master Clone ID : 400471
IMAGE ID : 100067448
Original Clone ID : FLH482743.01L

Organism


TAX_ID : 9606
Species Specific ID: 7529

Genome

Chromosome : 20
Map Location : 20q13.1
Ensembl : ENSG00000166913