DNASU Plasmid Repository • 480.965.5697 | Email

ITGB2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ITGB2
Gene Name:  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH482936.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00296594

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2307nts        
Open reading frame : 23 to 2329
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGG
GCTGCTCTCCCTCGGGTGCGTCCTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTG
CCGGGAATGCATCGAGTCGGGGCCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGG
GCCGGGGGATCCTGACTCCATTCGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTG
TGCGGCTGACGACATCATGGACCCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGG
GGGCCAGAAGCAGCTGTCCCCACAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGC
AGCGTTCAACGTGACCTTCCGGCGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGAT
GGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCT
GCTCCGGGCCCTCAACGAGATCACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGA
CAAGACCGTGCTGCCGTTCGTGAACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAA
CAAGGAGAAAGAGTGCCAGCCCCCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAA
CTCCAACCAGTTTCAGACCGAGGTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACC
CGAGGGTGGGCTGGACGCCATGATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCG
CAACGTCACGCGGCTGCTGGTGTTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGG
GAAGCTGGGCGCCATCCTGACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTA
CAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGA
AAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACT
CACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGT
CCATCTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGC
CCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAG
GAACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGT
GAAGGTCACGGCCACAGAGTGCATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTT
CACGGACATAGTGACCGTGCAGGTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAG
CAGAGACCGCAGCCTCTGCCATGGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGA
CACTGGCTACATTGGGAAAAACTGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCT
GGAAGGAAGCTGCCGGAAGGACAACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGT
CTGCGGGCAGTGCCTGTGCCACACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTA
CTGCGAGTGTGACACCATCAACTGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGG
GAGGGGGCTCTGCTTCTGCGGGAAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTG
CCAGTGCGAGAGGACCACTGAGGGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCG
TGGCCGGTGCCGCTGCAACGTATGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCA
GGAGTGCCCCGGCTGCCCCTCACCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAA
GTTCGAAAAGGGCCCCTTTGGGAAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTC
GAACAACCCCGTGAAGGGCAGGACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGC
CTACACGCTGGAGCAGCAGGACGGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCG
AGAGTGTGTGGCAGGCCCCAACATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGT
GCTGATCGGCATTCTCCTGCTGGTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCG
GGAGTACAGGCGCTTTGAGAAGGAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCT
TTTCAAGAGCGCCACCACGACGGTCATGAACCCCAAGTTTGCTGAGAGTTGGATCCACCC
AGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2354
Start on reference sequence 45
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ITGB2
Symbol Nomenclature : ITGB2
SYNONYM : CD18; LAD; LCAMB; LFA-1; MAC-1; MF17; MFI7
Designation : cell surface adhesion glycoprotein LFA-1/CR3/P150,959 beta subunit precursor)|cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta|complement receptor C3 beta-subunit|complement receptor C3 subunit beta|integrin beta chain, beta 2|integrin beta-2|leukocyte cell adhesion molecule CD18|leukocyte-associated antigens CD18/11A, CD18/11B, CD18/11C
Full Nomenclature : integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
GENEID : 3689
GI : 190690492
GenBank Accession : EU832689
HGNC : 6155
MIM : 600065
Vega : OTTHUMG00000090257
Target GenBank: BC005861.2

 

Reference Sequence Alignment

  

HsCD00296594        GTACAAAAAAGCAGGCTCCACCATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGG
NM_000211.3         ----------------------ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGG
NM_001127491.1      ----------------------ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGG
                                          *********************** **************

HsCD00296594        GCTGCTCTCCCTCGGGTGCGTCCTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTG
NM_000211.3         GCTGCTCTCCCTCGGGTGCGTCCTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTG
NM_001127491.1      GCTGCTCTCCCTCGGGTGCGTCCTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTG
                    ************************************************************

HsCD00296594        CCGGGAATGCATCGAGTCGGGGCCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGG
NM_000211.3         CCGGGAATGCATCGAGTCGGGGCCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGG
NM_001127491.1      CCGGGAATGCATCGAGTCGGGGCCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGG
                    ************************************************************

HsCD00296594        GCCGGGGGATCCTGACTCCATTCGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTG
NM_000211.3         GCCGGGGGATCCTGACTCCATTCGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTG
NM_001127491.1      GCCGGGGGATCCTGACTCCATTCGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTG
                    ************************************************************

HsCD00296594        TGCGGCTGACGACATCATGGACCCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGG
NM_000211.3         TGCGGCTGACGACATCATGGACCCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGG
NM_001127491.1      TGCGGCTGACGACATCATGGACCCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGG
                    ************************************************************

HsCD00296594        GGGCCAGAAGCAGCTGTCCCCACAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGC
NM_000211.3         GGGCCAGAAGCAGCTGTCCCCACAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGC
NM_001127491.1      GGGCCAGAAGCAGCTGTCCCCACAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGC
                    ************************************************************

HsCD00296594        AGCGTTCAACGTGACCTTCCGGCGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGAT
NM_000211.3         AGCGTTCAACGTGACCTTCCGGCGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGAT
NM_001127491.1      AGCGTTCAACGTGACCTTCCGGCGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGAT
                    ************************************************************

HsCD00296594        GGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCT
NM_000211.3         GGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCT
NM_001127491.1      GGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCT
                    ************************************************************

HsCD00296594        GCTCCGGGCCCTCAACGAGATCACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGA
NM_000211.3         GCTCCGGGCCCTCAACGAGATCACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGA
NM_001127491.1      GCTCCGGGCCCTCAACGAGATCACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGA
                    ************************************************************

HsCD00296594        CAAGACCGTGCTGCCGTTCGTGAACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAA
NM_000211.3         CAAGACCGTGCTGCCGTTCGTGAACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAA
NM_001127491.1      CAAGACCGTGCTGCCGTTCGTGAACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAA
                    ************************************************************

HsCD00296594        CAAGGAGAAAGAGTGCCAGCCCCCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAA
NM_000211.3         CAAGGAGAAAGAGTGCCAGCCCCCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAA
NM_001127491.1      CAAGGAGAAAGAGTGCCAGCCCCCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAA
                    ************************************************************

HsCD00296594        CTCCAACCAGTTTCAGACCGAGGTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACC
NM_000211.3         CTCCAACCAGTTTCAGACCGAGGTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACC
NM_001127491.1      CTCCAACCAGTTTCAGACCGAGGTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACC
                    ************************************************************

HsCD00296594        CGAGGGTGGGCTGGACGCCATGATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCG
NM_000211.3         CGAGGGTGGGCTGGACGCCATGATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCG
NM_001127491.1      CGAGGGTGGGCTGGACGCCATGATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCG
                    ************************************************************

HsCD00296594        CAACGTCACGCGGCTGCTGGTGTTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGG
NM_000211.3         CAACGTCACGCGGCTGCTGGTGTTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGG
NM_001127491.1      CAACGTCACGCGGCTGCTGGTGTTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGG
                    ************************************************************

HsCD00296594        GAAGCTGGGCGCCATCCTGACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTA
NM_000211.3         GAAGCTGGGCGCCATCCTGACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTA
NM_001127491.1      GAAGCTGGGCGCCATCCTGACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTA
                    ************************************************************

HsCD00296594        CAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGA
NM_000211.3         CAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGA
NM_001127491.1      CAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGA
                    ************************************************************

HsCD00296594        AAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACT
NM_000211.3         AAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACT
NM_001127491.1      AAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACT
                    ************************************************************

HsCD00296594        CACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGT
NM_000211.3         CACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGT
NM_001127491.1      CACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGT
                    ************************************************************

HsCD00296594        CCATCTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGC
NM_000211.3         CCAACTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGC
NM_001127491.1      CCAACTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGC
                    ***:**************************************.*****************

HsCD00296594        CCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAG
NM_000211.3         CCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAG
NM_001127491.1      CCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAG
                    ************************************************************

HsCD00296594        GAACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGT
NM_000211.3         GAACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGT
NM_001127491.1      GAACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGT
                    ************************************************************

HsCD00296594        GAAGGTCACGGCCACAGAGTGCATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTT
NM_000211.3         GAAGGTCACGGCCACAGAGTGCATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTT
NM_001127491.1      GAAGGTCACGGCCACAGAGTGCATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTT
                    ************************************************************

HsCD00296594        CACGGACATAGTGACCGTGCAGGTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAG
NM_000211.3         CACGGACATAGTGACCGTGCAGGTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAG
NM_001127491.1      CACGGACATAGTGACCGTGCAGGTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAG
                    ************************ ***********************************

HsCD00296594        CAGAGACCGCAGCCTCTGCCATGGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGA
NM_000211.3         CAGAGACCGCAGCCTCTGCCATGGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGA
NM_001127491.1      CAGAGACCGCAGCCTCTGCCATGGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGA
                    ************************************************************

HsCD00296594        CACTGGCTACATTGGGAAAAACTGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCT
NM_000211.3         CACTGGCTACATTGGGAAAAACTGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCT
NM_001127491.1      CACTGGCTACATTGGGAAAAACTGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCT
                    ************************************************************

HsCD00296594        GGAAGGAAGCTGCCGGAAGGACAACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGT
NM_000211.3         GGAAGGAAGCTGCCGGAAGGACAACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGT
NM_001127491.1      GGAAGGAAGCTGCCGGAAGGACAACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGT
                    ************************************************************

HsCD00296594        CTGCGGGCAGTGCCTGTGCCACACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTA
NM_000211.3         CTGCGGGCAGTGCCTGTGCCACACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTA
NM_001127491.1      CTGCGGGCAGTGCCTGTGCCACACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTA
                    ************************************************************

HsCD00296594        CTGCGAGTGTGACACCATCAACTGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGG
NM_000211.3         CTGCGAGTGTGACACCATCAACTGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGG
NM_001127491.1      CTGCGAGTGTGACACCATCAACTGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGG
                    ************************************************************

HsCD00296594        GAGGGGGCTCTGCTTCTGCGGGAAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTG
NM_000211.3         GAGGGGGCTCTGCTTCTGCGGGAAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTG
NM_001127491.1      GAGGGGGCTCTGCTTCTGCGGGAAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTG
                    ************************************************************

HsCD00296594        CCAGTGCGAGAGGACCACTGAGGGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCG
NM_000211.3         CCAGTGCGAGAGGACCACTGAGGGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCG
NM_001127491.1      CCAGTGCGAGAGGACCACTGAGGGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCG
                    ************************************************************

HsCD00296594        TGGCCGGTGCCGCTGCAACGTATGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCA
NM_000211.3         TGGCCGGTGCCGCTGCAACGTATGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCA
NM_001127491.1      TGGCCGGTGCCGCTGCAACGTATGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCA
                    ************************************************************

HsCD00296594        GGAGTGCCCCGGCTGCCCCTCACCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAA
NM_000211.3         GGAGTGCCCCGGCTGCCCCTCACCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAA
NM_001127491.1      GGAGTGCCCCGGCTGCCCCTCACCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAA
                    ************************************************************

HsCD00296594        GTTCGAAAAGGGCCCCTTTGGGAAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTC
NM_000211.3         GTTCGAAAAGGGCCCCTTTGGGAAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTC
NM_001127491.1      GTTCGAAAAGGGCCCCTTTGGGAAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTC
                    ************************************************************

HsCD00296594        GAACAACCCCGTGAAGGGCAGGACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGC
NM_000211.3         GAACAACCCCGTGAAGGGCAGGACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGC
NM_001127491.1      GAACAACCCCGTGAAGGGCAGGACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGC
                    ************************************************************

HsCD00296594        CTACACGCTGGAGCAGCAGGACGGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCG
NM_000211.3         CTACACGCTGGAGCAGCAGGACGGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCG
NM_001127491.1      CTACACGCTGGAGCAGCAGGACGGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCG
                    ************************************************************

HsCD00296594        AGAGTGTGTGGCAGGCCCCAACATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGT
NM_000211.3         AGAGTGTGTGGCAGGCCCCAACATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGT
NM_001127491.1      AGAGTGTGTGGCAGGCCCCAACATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGT
                    ************************************************************

HsCD00296594        GCTGATCGGCATTCTCCTGCTGGTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCG
NM_000211.3         GCTGATCGGCATTCTCCTGCTGGTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCG
NM_001127491.1      GCTGATCGGCATTCTCCTGCTGGTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCG
                    ************************************************************

HsCD00296594        GGAGTACAGGCGCTTTGAGAAGGAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCT
NM_000211.3         GGAGTACAGGCGCTTTGAGAAGGAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCT
NM_001127491.1      GGAGTACAGGCGCTTTGAGAAGGAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCT
                    ************************************************************

HsCD00296594        TTTCAAGAGCGCCACCACGACGGTCATGAACCCCAAGTTTGCTGAGAGTTGGATCCACCC
NM_000211.3         TTTCAAGAGCGCCACCACGACGGTCATGAACCCCAAGTTTGCTGAGAGTTAG--------
NM_001127491.1      TTTCAAGAGCGCCACCACGACGGTCATGAACCCCAAGTTTGCTGAGAGTTAG--------
                    **************************************************.*        

HsCD00296594        AGCTTTCTTGTAC
NM_000211.3         -------------
NM_001127491.1      -------------
                                 

Pathways

NCI : amb2 Integrin signaling
NCI : Beta2 integrin cell surface interactions
NCI : CXCR3-mediated signaling events
NCI : HIF-1-alpha transcription factor network
NCI : Integrin family cell surface interactions
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Innate Immune System
Reactome : Integrin cell surface interactions
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion

Clone

Cloning Information : 482936
HIP Master Clone ID : 400664
IMAGE ID : 100067718
Original Clone ID : FLH482936.01L

Organism


TAX_ID : 9606
Species Specific ID: 3689

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000160255

Reagents

Labome : CD18-antibody