DNASU Plasmid Repository • 480.965.5697 | Email

NCAM1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NCAM1
Gene Name:  neural cell adhesion molecule 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH483169.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00296827

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2577nts         Open reading frame : 23 to 2599
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTT
CCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGT
TGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTC
CTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTG
GAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCAT
TTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAA
GATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGA
AGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACA
CAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTA
CCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAAT
CCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTAC
CATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCT
GGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACA
GATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGAC
CATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGC
TGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGT
AGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGG
AGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAA
GGCTTCGTGGACTCGACCAGAGAAGCAAGAGACTCTGGATGGGCACATGGTGGTGCGTAG
CCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTACACTGATGCCGGAGAGTA
CATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTCCATGTACCTTGAAGTGCA
ATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTGGGAGGGGAACCAGGTGAA
CATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTCATGGTTTCGGGATGGCCA
GCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAACACCCCCTCTGCCAGCTA
TCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTACAACTGTACTGCAGTGAA
CCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGCAGACACCCCCTCTTCACC
ATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGTGCAGTTTGATGAACCAGA
GGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTGGAGAGCAGTGGGTGAAGA
AGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCATGGAGGGCATCGTCACCAT
CGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGCGGCGCTCAATGGCAAAGG
GCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCCAGTCCAAGGGGAACCCAG
TGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTCTATTAAAGTGAACCTGAT
CAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGTCAGGTACCGAGCGCTCTC
CTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGACCACGTCATGCTGAAGTC
CCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGAGAACCAGCAAGGAAAATC
CAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCACAGCCATCCCAGCCAACGG
CAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCATCCTCATCGTCATCTTCGT
CCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAACAAGTGTGGCCTGTTCAT
GTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGCCAAGGGCAAGGACATGGA
GGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCCCATCGTGGAGGTTCGAAC
GGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACACAGAGCCCAACGAGACCAC
GCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCCAGAGTGCCAGGAGACAGA
AACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGACGCCACACAGACAAAGGA
GAACGCGAACAAAGCATGAATCCACCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2755
Start on reference sequence 179
Mutations:
None
Discrepancy:
a2564c,E855A
                                

5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGGATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site Att P2 Primer 3026 3043
primer site U19 primer 517 535
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
selectable marker KanR kanamycin resistance gene 3156 3965
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NCAM1
Symbol Nomenclature : NCAM1
SYNONYM : CD56; MSK39; NCAM
Designation : antigen recognized by monoclonal antibody 5.1H11|neural cell adhesion molecule, NCAM
Full Nomenclature : neural cell adhesion molecule 1
GENEID : 4684
GI : 190692082
GenBank Accession : EU832805
HGNC : 7656
MIM : 116930
Vega : OTTHUMG00000167196
Target GenBank: BC047244.1

 

Reference Sequence Alignment

  

HsCD00296827        GTACAAAAAAGCAGGCTCCACCATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTT
NM_181351.4         ----------------------ATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTT
NM_000615.6         ----------------------ATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTT
NM_001242607.1      ----------------------ATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTT
                                          **************************************

HsCD00296827        CCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGT
NM_181351.4         CCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGT
NM_000615.6         CCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGT
NM_001242607.1      CCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGT
                    ************************************************************

HsCD00296827        TGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTC
NM_181351.4         TGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTC
NM_000615.6         TGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTC
NM_001242607.1      TGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTC
                    ************************************************************

HsCD00296827        CTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTG
NM_181351.4         CTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTG
NM_000615.6         CTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTG
NM_001242607.1      CTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTG
                    ************************************************************

HsCD00296827        GAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCAT
NM_181351.4         GAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCAT
NM_000615.6         GAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCAT
NM_001242607.1      GAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCAT
                    ************************************************************

HsCD00296827        TTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAA
NM_181351.4         TTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAA
NM_000615.6         TTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAA
NM_001242607.1      TTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAA
                    ************************************************************

HsCD00296827        GATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGA
NM_181351.4         GATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGA
NM_000615.6         GATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGA
NM_001242607.1      GATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGA
                    ************************************************************

HsCD00296827        AGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACA
NM_181351.4         AGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACA
NM_000615.6         AGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACA
NM_001242607.1      AGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACA
                    ************************************************************

HsCD00296827        CAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTA
NM_181351.4         CAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTA
NM_000615.6         CAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTA
NM_001242607.1      CAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTA
                    ************************************************************

HsCD00296827        CCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAAT
NM_181351.4         CCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAAT
NM_000615.6         CCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAAT
NM_001242607.1      CCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAAT
                    ************************************************************

HsCD00296827        CCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTAC
NM_181351.4         CCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTAC
NM_000615.6         CCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTAC
NM_001242607.1      CCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTAC
                    ************************************************************

HsCD00296827        CATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCT
NM_181351.4         CATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCT
NM_000615.6         CATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCT
NM_001242607.1      CATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCT
                    ************************************************************

HsCD00296827        GGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACA
NM_181351.4         GGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACA
NM_000615.6         GGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACA
NM_001242607.1      GGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACA
                    ************************************************************

HsCD00296827        GATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGAC
NM_181351.4         GATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGAC
NM_000615.6         GATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGAC
NM_001242607.1      GATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGAC
                    ************************************************************

HsCD00296827        CATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGC
NM_181351.4         CATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGC
NM_000615.6         CATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGC
NM_001242607.1      CATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGC
                    ************************************************************

HsCD00296827        TGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGT
NM_181351.4         TGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGT
NM_000615.6         TGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGT
NM_001242607.1      TGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGT
                    ************************************************************

HsCD00296827        AGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGG
NM_181351.4         AGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGG
NM_000615.6         AGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGG
NM_001242607.1      AGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGG
                    ************************************************************

HsCD00296827        AGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAA
NM_181351.4         AGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAA
NM_000615.6         AGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAA
NM_001242607.1      AGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAA
                    ************************************************************

HsCD00296827        GGCTTCGTGGACTCGACCAGAGAAGCAAGAG-----------------------------
NM_181351.4         GGCTTCGTGGACTCGACCAGAGAAGCAAGAG-----------------------------
NM_000615.6         G-----------------------------------------------------------
NM_001242607.1      GGCTTCGTGGACTCGACCAGAGAAGCAAGAGGTACATGCACCATGGAACTGGCAAGTGGG
                    *                                                           

HsCD00296827        -------------------------------------------------ACTCTGGATGG
NM_181351.4         -------------------------------------------------ACTCTGGATGG
NM_000615.6         -------------------------------------------------ACTCTGGATGG
NM_001242607.1      CAGACAGAAAGGACAGGCTGGCAGTGCAGGTTTCCCAGGATCTCATGAGACTCTGGATGG
                                                                     ***********

HsCD00296827        GCACATGGTGGTGCGTAGCCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTA
NM_181351.4         GCACATGGTGGTGCGTAGCCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTA
NM_000615.6         GCACATGGTGGTGCGTAGCCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTA
NM_001242607.1      GCACATGGTGGTGCGTAGCCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTA
                    ************************************************************

HsCD00296827        CACTGATGCCGGAGAGTACATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTC
NM_181351.4         CACTGATGCCGGAGAGTACATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTC
NM_000615.6         CACTGATGCCGGAGAGTACATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTC
NM_001242607.1      CACTGATGCCGGAGAGTACATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTC
                    ************************************************************

HsCD00296827        CATGTACCTTGAAGTGCAATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTG
NM_181351.4         CATGTACCTTGAAGTGCAATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTG
NM_000615.6         CATGTACCTTGAAGTGCAATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTG
NM_001242607.1      CATGTACCTTGAAGTGCAATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTG
                    ************************************************************

HsCD00296827        GGAGGGGAACCAGGTGAACATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTC
NM_181351.4         GGAGGGGAACCAGGTGAACATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTC
NM_000615.6         GGAGGGGAACCAGGTGAACATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTC
NM_001242607.1      GGAGGGGAACCAGGTGAACATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTC
                    ************************************************************

HsCD00296827        ATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAA
NM_181351.4         ATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAA
NM_000615.6         ATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAA
NM_001242607.1      ATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAA
                    ************************************************************

HsCD00296827        CACCCCCTCTGCCAGCTATCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTA
NM_181351.4         CACCCCCTCTGCCAGCTATCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTA
NM_000615.6         CACCCCCTCTGCCAGCTATCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTA
NM_001242607.1      CACCCCCTCTGCCAGCTATCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTA
                    ************************************************************

HsCD00296827        CAACTGTACTGCAGTGAACCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGC
NM_181351.4         CAACTGTACTGCAGTGAACCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGC
NM_000615.6         CAACTGTACTGCAGTGAACCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGC
NM_001242607.1      CAACTGTACTGCAGTGAACCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGC
                    ************************************************************

HsCD00296827        AGACACCCCCTCTTCACCATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGT
NM_181351.4         AGACACCCCCTCTTCACCATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGT
NM_000615.6         AGACACCCCCTCTTCACCATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGT
NM_001242607.1      AGACACCCCCTCTTCACCATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGT
                    ************************************************************

HsCD00296827        GCAGTTTGATGAACCAGAGGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTG
NM_181351.4         GCAGTTTGATGAACCAGAGGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTG
NM_000615.6         GCAGTTTGATGAACCAGAGGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTG
NM_001242607.1      GCAGTTTGATGAACCAGAGGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTG
                    ************************************************************

HsCD00296827        GAGAGCAGTGGGTGAAGAAGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCAT
NM_181351.4         GAGAGCAGTTGGTGAAGAAGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCAT
NM_000615.6         GAGAGCAGTTGGTGAAGAAGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCAT
NM_001242607.1      GAGAGCAGTTGGTGAAGAAGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCAT
                    ********* **************************************************

HsCD00296827        GGAGGGCATCGTCACCATCGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGC
NM_181351.4         GGAGGGCATCGTCACCATCGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGC
NM_000615.6         GGAGGGCATCGTCACCATCGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGC
NM_001242607.1      GGAGGGCATCGTCACCATCGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGC
                    ************************************************************

HsCD00296827        GGCGCTCAATGGCAAAGGGCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCC
NM_181351.4         GGCGCTCAATGGCAAAGGGCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCC
NM_000615.6         GGCGCTCAATGGCAAAGGGCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCC
NM_001242607.1      GGCGCTCAATGGCAAAGGGCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCC
                    ************************************************************

HsCD00296827        AGTCCAAGGGGAACCCAGTGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTC
NM_181351.4         AGTCCAAGGGGAACCCAGTGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTC
NM_000615.6         AGTCCAAGGGGAACCCAGTGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTC
NM_001242607.1      AGTCCAAGGGGAACCCAGTGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTC
                    ************************************************************

HsCD00296827        TATTAAAGTGAACCTGATCAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGT
NM_181351.4         TATTAAAGTGAACCTGATCAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGT
NM_000615.6         TATTAAAGTGAACCTGATCAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGT
NM_001242607.1      TATTAAAGTGAACCTGATCAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGT
                    ************************************************************

HsCD00296827        CAGGTACCGAGCGCTCTCCTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGA
NM_181351.4         CAGGTACCGAGCGCTCTCCTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGA
NM_000615.6         CAGGTACCGAGCGCTCTCCTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGA
NM_001242607.1      CAGGTACCGAGCGCTCTCCTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGA
                    ************************************************************

HsCD00296827        CCACGTCATGCTGAAGTCCCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGA
NM_181351.4         CCACGTCATGCTGAAGTCCCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGA
NM_000615.6         CCACGTCATGCTGAAGTCCCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGA
NM_001242607.1      CCACGTCATGCTGAAGTCCCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGA
                    ************************************************************

HsCD00296827        GAACCAGCAAGGAAAATCCAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCAC
NM_181351.4         GAACCAGCAAGGAAAATCCAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCAC
NM_000615.6         GAACCAGCAAGGAAAATCCAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCAC
NM_001242607.1      GAACCAGCAAGGAAAATCCAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCAC
                    ************************************************************

HsCD00296827        AGCCATCCCAGCCAACGGCAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCAT
NM_181351.4         AGCCATCCCAGCCAACGGCAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCAT
NM_000615.6         AGCCATCCCAGCCAACGGCAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCAT
NM_001242607.1      AGCCATCCCAGCCAACGGCAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCAT
                    ************************************************************

HsCD00296827        CCTCATCGTCATCTTCGTCCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAA
NM_181351.4         CCTCATCGTCATCTTCGTCCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAA
NM_000615.6         CCTCATCGTCATCTTCGTCCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAA
NM_001242607.1      CCTCATCGTCATCTTCGTCCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAA
                    ************************************************************

HsCD00296827        CAAGTGTGGCCTGTTCATGTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGC
NM_181351.4         CAAGTGTGGCCTGTTCATGTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGC
NM_000615.6         CAAGTGTGGCCTGTTCATGTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGC
NM_001242607.1      CAAGTGTGGCCTGTTCATGTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGC
                    ************************************************************

HsCD00296827        CAAGGGCAAGGACATGGAGGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCC
NM_181351.4         CAAGGGCAAGGACATGGAGGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCC
NM_000615.6         CAAGGGCAAGGACATGGAGGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCC
NM_001242607.1      CAAGGGCAAGGACATGGAGGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCC
                    ************************************************************

HsCD00296827        CATCGTGGAGGTTCGAACGGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACAC
NM_181351.4         CATCGTGGAGGTTCGAACGGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACAC
NM_000615.6         CATCGTGGAGGTTCGAACGGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACAC
NM_001242607.1      CATCGTGGAGGTTCGAACGGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACAC
                    ************************************************************

HsCD00296827        AGAGCCCAACGAGACCACGCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCC
NM_181351.4         AGAGCCCAACGAGACCACGCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCC
NM_000615.6         AGAGCCCAACGAGACCACGCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCC
NM_001242607.1      AGAGCCCAACGAGACCACGCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCC
                    ************************************************************

HsCD00296827        AGAGTGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGA
NM_181351.4         AGAGTGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGA
NM_000615.6         AGAGTGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGA
NM_001242607.1      AGAGTGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGA
                    ************************************************************

HsCD00296827        CGCCACACAGACAAAGGAGAACGCGAACAAAGCATGAATCCACCCAGCTTTCTTGTAC
NM_181351.4         CGCCACACAGACAAAGGAGAACGAGAGCAAAGCATGA---------------------
NM_000615.6         CGCCACACAGACAAAGGAGAACGAGAGCAAAGCATGA---------------------
NM_001242607.1      CGCCACACAGACAAAGGAGAACGAGAGCAAAGCATGA---------------------
                    ***********************.**.**********                     

Pathways

NCI : FGF signaling pathway
Reactome : Axon guidance
Reactome : Cytokine Signaling in Immune system
Reactome : Developmental Biology
Reactome : ECM proteoglycans
Reactome : Extracellular matrix organization
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : L1CAM interactions
Reactome : NCAM signaling for neurite out-growth
Reactome : NCAM1 interactions
Reactome : Signal transduction by L1

Protein

SMART domain : IGc2 : Immunoglobulin C-2 Type
SMART domain : IG : Immunoglobulin
SMART domain : FN3 : Fibronectin type 3 domain
UniProt : P13591
HPRD : 00301

Clone

Cloning Information : 483169
HIP Master Clone ID : 400897
IMAGE ID : 100067834
Original Clone ID : FLH483169.01X

Organism


TAX_ID : 9606
Species Specific ID: 4684

Genome

Chromosome : 11
Map Location : 11q23.1
Ensembl : ENSG00000149294

Reagents

Labome : CD56-antibody