DNASU Plasmid Repository • 480.965.5697 | Email

GNAS (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GNAS
Gene Name:  GNAS complex locus
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH483178.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00296836

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1143nts         Open reading frame : 23 to 1143
Reference Sequence Alignment

GTACAAAAAAGCAGGCTCCACCATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCG
CAACGAGGAGAAGGCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGA
CAAGCAGGTCTACCGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAA
AAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGACAGTGA
GAAGGCAACCAAAGTGCAGGACATCAAAAACAACCTGAAAGAGGCGATTGAAACCATTGT
GGCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACCCCGAGAACCAGTTCAG
AGTGGACTACATCCTGAGTGTGATGAACGTGCCTGACTTTGACTTCCCTCCCGAATTCTA
TGAGCATGCCAAGGCTCTGTGGGAGGATGAAGGAGTGCGTGCCTGCTACGAACGCTCCAA
CGAGTACCAGCTGATTGACTGTGCCCAGTACTTCCTGGACAAGATCGACGTGATCAAGCA
GGCTGACTATGTGCCGAGCGATCAGGACCTGCTTCGCTGCCGTGTCCTGACTTCTGGAAT
CTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTTGACGTGGGTGGCCA
GCGCGATGAACGCCGCAAGTGGATCCAGTGCTTCAACGATGTGACTGCCATCATCTTCGT
GGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACCAGACCAACCGCCTGCA
GGAGGCTCTGAACCCCTTCAAGAGCATCTGGAACAACAGATGGCTGCGCACCATCTCTGT
GATCCTGTTCCTCAACAAGCAAGATCTGCTCGCTGAGAAAGTCCTTGCTGGGAAATCGAA
GATTGAGGACTACTTTCCAGAATTTGCTCGCTACACTACTCCTGAGGATGCTACTCCCGA
GCCCGGAGAGGACCCACGCGTGACCCGGGCCAAGTACTTCATTCGAGATGAGTTTCTGAG
GATCAGCACTGCCAGTGGAGATGGGCGTCACTACTGCTACCCTCATTTCACCTGCGCTGT
GGACACTGAGAACATCCGCCGTGTGTTCAACGACTGCCGTGACATCATTCAGCGCATGCA
CCTTCGTCAGTACGAGCTGCTCTGAATCCACCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1459
Start on reference sequence 317
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
TGGATCCacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GNAS
Symbol Nomenclature : GNAS
SYNONYM : AHO; C20orf45; GNAS1; GPSA; GSA; GSP; NESP; PHP1A; PHP1B; PHP1C; POH
Designation : adenylate cyclase-stimulating G alpha protein|alternative gene product encoded by XL-exon|extra large alphas protein|guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1|guanine nucleotide regulatory protein|guanine nucleotide-binding protein G(s) subunit alpha isoforms XLas|neuroendocrine secretory protein|protein ALEX|secretogranin VI
Full Nomenclature : GNAS complex locus
GENEID : 2778
Locus Tag : RP4-543J19.4
GI : 190691490
GenBank Accession : EU832170
HGNC : 4392
MIM : 139320
Vega : OTTHUMG00000033069
Target GenBank: BC089157.1

 

Reference Sequence Alignment

  

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         ATGGGCGTGCGCAACTGCCTCTACGGCAATAATATGTCAGGACAACGCGATATCCCCCCT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GAAATCGGGGAACAGCCCGAGCAACCACCTTTGGAGGCCCCAGGGGCAGCTGCCCCCGGT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GCTGGGCCTAGCCCAGCCGAAGAGATGGAGACCGAACCGCCTCACAACGAGCCCATCCCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GTCGAGAATGATGGCGAGGCCTGTGGACCCCCAGAGGTCTCCAGACCCAACTTTCAGGTC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CTCAACCCGGCATTCAGGGAAGCTGGAGCCCATGGAAGCTACAGCCCACCTCCTGAGGAA
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GCAATGCCCTTCGAGGCTGAACAGCCCAGCTTGGGAGGCTTCTGGCCTACACTGGAGCAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CCTGGATTCCCCAGTGGGGTCCATGCAGGCCTTGAGGCCTTCGGCCCAGCACTCATGGAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CCCGGAGCCTTCAGTGGTGCCAGACCAGGCCTGGGAGGATACAGCCCTCCACCAGAAGAA
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GCTATGCCCTTTGAGTTTGACCAGCCTGCCCAGAGAGGCTGCAGTCAACTTCTCTTACAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GTCCCAGACCTTGCTCCAGGAGGCCCAGGTGCTGCAGGGGTCCCCGGAGCTCCTCCCGAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GAGCCCCAAGCCCTCAGGCCTGCAAAGGCTGGCTCCAGAGGAGGCTACAGCCCTCCCCCT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GAGGAGACTATGCCATTTGAGCTTGATGGAGAAGGATTTGGGGACGACAGCCCACCCCCG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GGGCTTTCCCGAGTTATCGCACAAGTCGACGGCAGCAGCCAGTTCGCGGCAGTCGCGGCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         TCGAGTGCGGTCCGCCTCACTCCCGCCGCGAACGCGCCTCCCCTCTGGGTCCCAGGCGCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         ATCGGCAGCCCATCCCAAGAGGCTGTCAGACCTCCTTCTAACTTCACGGGCAGCAGCCCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         TGGATGGAGATCTCCGGACCCCCGTTCGAGATTGGCAGCGCCCCCGCTGGGGTCGACGAC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         ACTCCCGTCAACATGGACAGCCCCCCAATCGCGCTTGACGGCCCGCCCATCAAGGTCTCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GGAGCCCCAGATAAGAGAGAGCGAGCAGAGAGACCCCCAGTTGAGGAGGAAGCAGCAGAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         ATGGAAGGAGCCGCTGATGCCGCGGAGGGAGGAAAAGTACCCTCTCCGGGGTACGGATCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CCTGCCGCCGGGGCAGCCTCAGCGGATACCGCTGCCAGGGCAGCCCCTGCAGCCCCAGCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GATCCTGACTCCGGGGCAACCCCAGAAGATCCCGACTCCGGGACAGCACCAGCCGATCCT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GACTCCGGGGCATTCGCAGCCGATCCCGACTCCGGGGCAGCCCCTGCCGCCCCAGCCGAT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CCCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCCTGAC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GCCCCAGCCGATCCAGATGCCGGGGCGGCCCCTGAGGCTCCCGCCGCCCCTGCGGCTGCT
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GAGACCCGGGCAGCCCATGTCGCCCCAGCTGCGCCAGACGCAGGGGCTCCCACTGCCCCA
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GCCGCTTCTGCCACCCGGGCAGCCCAAGTCCGCCGGGCGGCCTCTGCAGCCCCTGCCTCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GGGGCCAGACGCAAGATCCATCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCCGATCCG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CCTACTCCGCGGCCTACTCGCGCGTCTGCCTGGCGGGGCAAGTCCGAGAGCAGCCGCGGC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CGCCGCGTGTACTACGATGAAGGGGTGGCCAGCAGCGACGATGACTCCAGCGGAGACGAG
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         TCCGACGATGGGACCTCCGGATGCCTCCGCTGGTTTCAGCATCGGCGAAATCGCCGCCGC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        ------------------------------------------------------------
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         CGAAAGCCCCAGCGCAACTTACTCCGCAACTTTCTCGTGCAAGCCTTCGGGGGCTGCTTC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        -----------------------------------------------GTACAAAAAAGCA
NM_001077489.2      ------------------------------------------------------------
NM_080426.2         ------------------------------------------------------------
NM_001077488.2      ------------------------------------------------------------
NM_080425.2         GGTCGATCTGAGAGTCCCCAGCCCAAAGCCTCGCGCTCTCTCAAGGTCAAGAAGGTACCC
NM_000516.4         ------------------------------------------------------------
                                                                                

HsCD00296836        GGCTCCACCATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAG
NM_001077489.2      ---------ATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAG
NM_080426.2         ---------ATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAG
NM_001077488.2      ---------ATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAG
NM_080425.2         CTGGCGGAGAAGCGCAGACAGATGCGCAAAGAAGCCCTGGAGAAGCGGGCCCAGAAGCGC
NM_000516.4         ---------ATGGGCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAG
                             *:* **:*.*: . *..**.:.*..** :*** .**** ..* **.**.. 

HsCD00296836        GCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTAC
NM_001077489.2      GCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTAC
NM_080426.2         GCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTAC
NM_001077488.2      GCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTAC
NM_080425.2         GCAGAGAAGAAACGCAGTAAGCTCATCGACAAACAACTCCAGGACGAAAAGATGGGCTAC
NM_000516.4         GCGCAGCGTGAGGCCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTAC
                    **. **.. .*.  **. **..: ***** **.**.** ***.* **.***.:** ****

HsCD00296836        CGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_001077489.2      CGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_080426.2         CGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_001077488.2      CGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_080425.2         ATGTGTACGCACCGCCTGCTGCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_000516.4         CGGGCCACGCACCGCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
                    . *   ***************** **.*********************************

HsCD00296836        AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATG-----------------------
NM_001077489.2      AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATG-----------------------
NM_080426.2         AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATG-----------------------
NM_001077488.2      AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
NM_080425.2         AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
NM_000516.4         AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
                    *************************************                       

HsCD00296836        ----------------------GAGACAGTGAGAAGGCAACCAAAGTGCAGGACATCAAA
NM_001077489.2      ----------------------GAGATG---AGAAGGCAACCAAAGTGCAGGACATCAAA
NM_080426.2         ----------------------GAGACAGTGAGAAGGCAACCAAAGTGCAGGACATCAAA
NM_001077488.2      CAGGCTGCAAGGAGCAACAGCGATGGCAGTGAGAAGGCAACCAAAGTGCAGGACATCAAA
NM_080425.2         CAGGCTGCAAGGAG---CAACAGCGATGGTGAGAAGGCAACCAAAGTGCAGGACATCAAA
NM_000516.4         CAGGCTGCAAGGAGCAACAGCGATG---GTGAGAAGGCAACCAAAGTGCAGGACATCAAA
                                          . *      *****************************

HsCD00296836        AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
NM_001077489.2      AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
NM_080426.2         AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
NM_001077488.2      AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
NM_080425.2         AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
NM_000516.4         AACAACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCC
                    ************************************************************

HsCD00296836        GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
NM_001077489.2      GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
NM_080426.2         GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
NM_001077488.2      GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
NM_080425.2         GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
NM_000516.4         GTGGAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAAC
                    ************************************************************

HsCD00296836        GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
NM_001077489.2      GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
NM_080426.2         GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
NM_001077488.2      GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
NM_080425.2         GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
NM_000516.4         GTGCCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGAT
                    ************************************************************

HsCD00296836        GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
NM_001077489.2      GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
NM_080426.2         GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
NM_001077488.2      GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
NM_080425.2         GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
NM_000516.4         GAAGGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAG
                    ************************************************************

HsCD00296836        TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
NM_001077489.2      TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
NM_080426.2         TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
NM_001077488.2      TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
NM_080425.2         TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
NM_000516.4         TACTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGAC
                    ************************************************************

HsCD00296836        CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
NM_001077489.2      CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
NM_080426.2         CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
NM_001077488.2      CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
NM_080425.2         CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
NM_000516.4         CTGCTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAA
                    ************************************************************

HsCD00296836        GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
NM_001077489.2      GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
NM_080426.2         GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
NM_001077488.2      GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
NM_080425.2         GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
NM_000516.4         GTCAACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAG
                    ************************************************************

HsCD00296836        TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
NM_001077489.2      TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
NM_080426.2         TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
NM_001077488.2      TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
NM_080425.2         TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
NM_000516.4         TGCTTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTC
                    ************************************************************

HsCD00296836        ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCCCTTCAAGAGCATC
NM_001077489.2      ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATC
NM_080426.2         ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATC
NM_001077488.2      ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATC
NM_080425.2         ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATC
NM_000516.4         ATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATC
                    ********************************************** *************

HsCD00296836        TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
NM_001077489.2      TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
NM_080426.2         TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
NM_001077488.2      TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
NM_080425.2         TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
NM_000516.4         TGGAACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTG
                    ************************************************************

HsCD00296836        CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
NM_001077489.2      CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
NM_080426.2         CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
NM_001077488.2      CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
NM_080425.2         CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
NM_000516.4         CTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCT
                    ************************************************************

HsCD00296836        CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
NM_001077489.2      CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
NM_080426.2         CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
NM_001077488.2      CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
NM_080425.2         CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
NM_000516.4         CGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGG
                    ************************************************************

HsCD00296836        GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
NM_001077489.2      GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
NM_080426.2         GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
NM_001077488.2      GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
NM_080425.2         GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
NM_000516.4         GCCAAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGT
                    ************************************************************

HsCD00296836        CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
NM_001077489.2      CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
NM_080426.2         CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
NM_001077488.2      CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
NM_080425.2         CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
NM_000516.4         CACTACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTC
                    ************************************************************

HsCD00296836        AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTGAATC
NM_001077489.2      AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA---
NM_080426.2         AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA---
NM_001077488.2      AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA---
NM_080425.2         AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA---
NM_000516.4         AACGACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA---
                    *******************************************************.*   

HsCD00296836        CACCCAGCTTTCTTGTAC
NM_001077489.2      ------------------
NM_080426.2         ------------------
NM_001077488.2      ------------------
NM_080425.2         ------------------
NM_000516.4         ------------------
                                      

Pathways

Panther : Endothelin signaling pathway
Reactome : Aquaporin-mediated transport
Reactome : Class B/2 (Secretin family receptors)
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G alpha (z) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Glucagon-type ligand receptors
Reactome : Hemostasis
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : PKA activation in glucagon signalling
Reactome : Platelet homeostasis
Reactome : Prostacyclin signalling through prostacyclin receptor
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Transmembrane transport of small molecules
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Estrogen signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : TSH signaling pathway

Protein

SMART domain : G_alpha : G protein alpha subunit
UniProt : A6NI00
UniProt : O95467
UniProt : P84996
UniProt : P63092
UniProt : Q5JWF2
HPRD : 00761

Clone

Cloning Information : 483178
HIP Master Clone ID : 400906
IMAGE ID : 100067199
Original Clone ID : FLH483178.01X

Organism


TAX_ID : 9606
Species Specific ID: 2778

Genome

Chromosome : 20
Map Location : 20q13.3
Ensembl : ENSG00000087460

Reagents

Labome : GNAS-antibody