DNASU Plasmid Repository • 480.965.5697 | Email

SLC6A11 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC6A11
Gene Name:  solute carrier family 6 (neurotransmitter transporter), member 11
Sequence             
Original Clone ID: FLH269762.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00297090

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1896nts         Open reading frame : 35 to 1930
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGACGGCGGAGAAGGCGCTGCCCCT
GGGCAATGGGAAGGCTGCTGAGGAGGCGCGGGAGTCCGAGGCGCCGGGTGGCGGCTGCAG
CAGCGGGGGCGCGGCGCCCGCGCGCCACCCGCGCGTCAAGCGCGACAAGGCGGTCCACGA
GCGCGGCCACTGGAACAACAAGGTGGAGTTCGTGCTGAGCGTGGCCGGGGAGATCATTGG
GCTGGGCAACGTGTGGCGCTTCCCCTACCTGTGCTACAAGAACGGAGGAGGGGCATTCCT
GATTCCCTACGTGGTGTTTTTTATTTGCTGTGGAATTCCTGTTTTTTTCCTGGAGACAGC
TCTGGGGCAGTTCACAAGTGAAGGTGGCATTACGTGTTGGAGGAAAGTTTGCCCTTTATT
TGAAGGCATTGGCTATGCAACACAGGTGATTGAGGCCCATCTGAATGTGTACTACATCAT
CATCCTGGCATGGGCCATTTTTTACCTGAGCAACTGCTTCACTACTGAGCTACCCTGGGC
TACCTGTGGGCATGAGTGGAACACAGAGAATTGTGTGGAGTTCCAGAAACTGAATGTGAG
CAACTACAGCCATGTGTCTCTGCAGAATGCCACCTCCCCTGTCATGGAGTTTTGGGAGCA
CCGGGTCCTGGCCATCTCTGACGGGATCGAGCACATCGGGAACCTTCGCTGGGAGCTGGC
CTTGTGTCTCTTGGCAGCCTGGACCATCTGTTACTTCTGTATCTGGAAGGGGACCAAGTC
TACAGGAAAGGTTGTATACGTGACTGCGACATTCCCCTACATCATGCTGCTGATCCTCCT
GATACGAGGGGTCACGTTGCCCGGGGCCTCAGAGGGCATCAAGTTCTACTTGTACCCTGA
CCTCTCCCGGCTCTCCGACCCCCAGGTCTGGGTAGATGCTGGAACGCAGATCTTTTTCTC
CTATGCCATTTGCCTGGGCTGTCTGACCGCTCTGGGAAGTTATAACAATTATAACAACAA
CTGCTACAGGGACTGCATCATGCTCTGTTGCCTGAACAGCGGCACCAGCTTCGTGGCTGG
GTTTGCCATCTTCTCAGTCCTGGGTTTTATGGCGTACGAGCAGGGGGTACCCATTGCTGA
GGTGGCAGAGTCAGGCCCCGGCCTGGCCTTTATTGCGTACCCCAAGGCGGTCACCATGAT
GCCTCTCTCCCCGCTGTGGGCCACCTTGTTCTTCATGATGCTCATCTTCCTGGGCCTGGA
CAGCCAGTTTGTGTGTGTGGAAAGCCTGGTGACCGCCGTGGTGGACATGTACCCCAAGGT
TTTCCGGAGGGGTTACCGGCGGGAGCTGCTCATCCTAGCCTTGTCTGTTATCTCCTATTT
TCTGGGCCTCGTGATGTTAACAGAGGGTGGCATGTACATCTTCCAGCTCTTTGACTCCTA
TGCCGCCAGTGGGATGTGCCTTCTCTTCGTGGCCATCTTTGAGTGCATCTGCATCGGCTG
GGTGTATGGAAGCAACCGGTTCTATGATAACATTGAAGACATGATTGGCTACCGGCCACC
GTCGCTCATTAAGTGGTGCTGGATGATCATGACCCCTGGGATCTGCGCGGGGATCTTCAT
CTTCTTCTTGATCAAGTACAAGCCACTCAAGTACAACAACATCTACACCTACCCAGCCTG
GGGCTATGGCATTGGCTGGCTCATGGCCCTGTCCTCCATGCTCTGCATCCCGCTCTGGAT
CTGCATCACAGTGTGGAAGACGGAGGGGACACTGCCCGAGAAACTCCAGAAGTTGACGAC
CCCCAGCACAGATCTGAAAATGCGGGGCAAGCTTGGGGTGAGCCCACGGATGGTGACAGT
TAATGACTGTGATGCCAAACTCAAGAGTGACGGGACCATCGCAGCCATCACAGAGAAGGA
GACGCACTTCTCAGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 35
End on reference sequence 1933
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC6A11
Symbol Nomenclature : SLC6A11
SYNONYM : GAT-3; GAT3; GAT4
Designation : GABA transporter 3|sodium- and chloride-dependent GABA transporter 3|solute carrier family 6 (neurotransmitter transporter, GABA), member 11|solute carrier family 6 member 11
Full Nomenclature : solute carrier family 6 (neurotransmitter transporter), member 11
GENEID : 6538
GI : 157170217
GenBank Accession : BC152735
HGNC : 11044
MIM : 607952
Target GenBank: NM_014229.1

 

Reference Sequence Alignment

  

HsCD00297090      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGACGGCGGAGAAGGCGCTGCCCCT
NM_014229.1       ----------------------------------ATGACGGCGGAGAAGGCGCTGCCCCT
                                                    **************************

HsCD00297090      GGGCAATGGGAAGGCTGCTGAGGAGGCGCGGGAGTCCGAGGCGCCGGGTGGCGGCTGCAG
NM_014229.1       GGGCAATGGGAAGGCTGCTGAGGAGGCGCGGGAGTCCGAGGCGCCGGGTGGCGGCTGCAG
                  ************************************************************

HsCD00297090      CAGCGGGGGCGCGGCGCCCGCGCGCCACCCGCGCGTCAAGCGCGACAAGGCGGTCCACGA
NM_014229.1       CAGCGGGGGCGCGGCGCCCGCGCGCCACCCGCGCGTCAAGCGCGACAAGGCGGTCCACGA
                  ************************************************************

HsCD00297090      GCGCGGCCACTGGAACAACAAGGTGGAGTTCGTGCTGAGCGTGGCCGGGGAGATCATTGG
NM_014229.1       GCGCGGCCACTGGAACAACAAGGTGGAGTTCGTGCTGAGCGTGGCCGGGGAGATCATTGG
                  ************************************************************

HsCD00297090      GCTGGGCAACGTGTGGCGCTTCCCCTACCTGTGCTACAAGAACGGAGGAGGGGCATTCCT
NM_014229.1       GCTGGGCAACGTGTGGCGCTTCCCCTACCTGTGCTACAAGAACGGAGGAGGGGCATTCCT
                  ************************************************************

HsCD00297090      GATTCCCTACGTGGTGTTTTTTATTTGCTGTGGAATTCCTGTTTTTTTCCTGGAGACAGC
NM_014229.1       GATTCCCTACGTGGTGTTTTTTATTTGCTGTGGAATTCCTGTTTTTTTCCTGGAGACAGC
                  ************************************************************

HsCD00297090      TCTGGGGCAGTTCACAAGTGAAGGTGGCATTACGTGTTGGAGGAAAGTTTGCCCTTTATT
NM_014229.1       TCTGGGGCAGTTCACAAGTGAAGGTGGCATTACGTGTTGGAGGAAAGTTTGCCCTTTATT
                  ************************************************************

HsCD00297090      TGAAGGCATTGGCTATGCAACACAGGTGATTGAGGCCCATCTGAATGTGTACTACATCAT
NM_014229.1       TGAAGGCATTGGCTATGCAACACAGGTGATTGAGGCCCATCTGAATGTGTACTACATCAT
                  ************************************************************

HsCD00297090      CATCCTGGCATGGGCCATTTTTTACCTGAGCAACTGCTTCACTACTGAGCTACCCTGGGC
NM_014229.1       CATCCTGGCATGGGCCATTTTTTACCTGAGCAACTGCTTCACTACTGAGCTACCCTGGGC
                  ************************************************************

HsCD00297090      TACCTGTGGGCATGAGTGGAACACAGAGAATTGTGTGGAGTTCCAGAAACTGAATGTGAG
NM_014229.1       TACCTGTGGGCATGAGTGGAACACAGAGAATTGTGTGGAGTTCCAGAAACTGAATGTGAG
                  ************************************************************

HsCD00297090      CAACTACAGCCATGTGTCTCTGCAGAATGCCACCTCCCCTGTCATGGAGTTTTGGGAGCA
NM_014229.1       CAACTACAGCCATGTGTCTCTGCAGAATGCCACCTCCCCTGTCATGGAGTTTTGGGAGCA
                  ************************************************************

HsCD00297090      CCGGGTCCTGGCCATCTCTGACGGGATCGAGCACATCGGGAACCTTCGCTGGGAGCTGGC
NM_014229.1       CCGGGTCCTGGCCATCTCTGACGGGATCGAGCACATCGGGAACCTTCGCTGGGAGCTGGC
                  ************************************************************

HsCD00297090      CTTGTGTCTCTTGGCAGCCTGGACCATCTGTTACTTCTGTATCTGGAAGGGGACCAAGTC
NM_014229.1       CTTGTGTCTCTTGGCAGCCTGGACCATCTGTTACTTCTGTATCTGGAAGGGGACCAAGTC
                  ************************************************************

HsCD00297090      TACAGGAAAGGTTGTATACGTGACTGCGACATTCCCCTACATCATGCTGCTGATCCTCCT
NM_014229.1       TACAGGAAAGGTTGTATACGTGACTGCGACATTCCCCTACATCATGCTGCTGATCCTCCT
                  ************************************************************

HsCD00297090      GATACGAGGGGTCACGTTGCCCGGGGCCTCAGAGGGCATCAAGTTCTACTTGTACCCTGA
NM_014229.1       GATACGAGGGGTCACGTTGCCCGGGGCCTCAGAGGGCATCAAGTTCTACTTGTACCCTGA
                  ************************************************************

HsCD00297090      CCTCTCCCGGCTCTCCGACCCCCAGGTCTGGGTAGATGCTGGAACGCAGATCTTTTTCTC
NM_014229.1       CCTCTCCCGGCTCTCCGACCCCCAGGTCTGGGTAGATGCTGGAACGCAGATCTTTTTCTC
                  ************************************************************

HsCD00297090      CTATGCCATTTGCCTGGGCTGTCTGACCGCTCTGGGAAGTTATAACAATTATAACAACAA
NM_014229.1       CTATGCCATTTGCCTGGGCTGTCTGACCGCTCTGGGAAGTTATAACAATTATAACAACAA
                  ************************************************************

HsCD00297090      CTGCTACAGGGACTGCATCATGCTCTGTTGCCTGAACAGCGGCACCAGCTTCGTGGCTGG
NM_014229.1       CTGCTACAGGGACTGCATCATGCTCTGTTGCCTGAACAGCGGCACCAGCTTCGTGGCTGG
                  ************************************************************

HsCD00297090      GTTTGCCATCTTCTCAGTCCTGGGTTTTATGGCGTACGAGCAGGGGGTACCCATTGCTGA
NM_014229.1       GTTTGCCATCTTCTCAGTCCTGGGTTTTATGGCGTACGAGCAGGGGGTACCCATTGCTGA
                  ************************************************************

HsCD00297090      GGTGGCAGAGTCAGGCCCCGGCCTGGCCTTTATTGCGTACCCCAAGGCGGTCACCATGAT
NM_014229.1       GGTGGCAGAGTCAGGCCCCGGCCTGGCCTTTATTGCGTACCCCAAGGCGGTCACCATGAT
                  ************************************************************

HsCD00297090      GCCTCTCTCCCCGCTGTGGGCCACCTTGTTCTTCATGATGCTCATCTTCCTGGGCCTGGA
NM_014229.1       GCCTCTCTCCCCGCTGTGGGCCACCTTGTTCTTCATGATGCTCATCTTCCTGGGCCTGGA
                  ************************************************************

HsCD00297090      CAGCCAGTTTGTGTGTGTGGAAAGCCTGGTGACCGCCGTGGTGGACATGTACCCCAAGGT
NM_014229.1       CAGCCAGTTTGTGTGTGTGGAAAGCCTGGTGACCGCCGTGGTGGACATGTACCCCAAGGT
                  ************************************************************

HsCD00297090      TTTCCGGAGGGGTTACCGGCGGGAGCTGCTCATCCTAGCCTTGTCTGTTATCTCCTATTT
NM_014229.1       TTTCCGGAGGGGTTACCGGCGGGAGCTGCTCATCCTAGCCTTGTCTGTTATCTCCTATTT
                  ************************************************************

HsCD00297090      TCTGGGCCTCGTGATGTTAACAGAGGGTGGCATGTACATCTTCCAGCTCTTTGACTCCTA
NM_014229.1       TCTGGGCCTCGTGATGTTAACAGAGGGTGGCATGTACATCTTCCAGCTCTTTGACTCCTA
                  ************************************************************

HsCD00297090      TGCCGCCAGTGGGATGTGCCTTCTCTTCGTGGCCATCTTTGAGTGCATCTGCATCGGCTG
NM_014229.1       TGCCGCCAGTGGGATGTGCCTTCTCTTCGTGGCCATCTTTGAGTGCATCTGCATCGGCTG
                  ************************************************************

HsCD00297090      GGTGTATGGAAGCAACCGGTTCTATGATAACATTGAAGACATGATTGGCTACCGGCCACC
NM_014229.1       GGTGTATGGAAGCAACCGGTTCTATGATAACATTGAAGACATGATTGGCTACCGGCCACC
                  ************************************************************

HsCD00297090      GTCGCTCATTAAGTGGTGCTGGATGATCATGACCCCTGGGATCTGCGCGGGGATCTTCAT
NM_014229.1       GTCGCTCATTAAGTGGTGCTGGATGATCATGACCCCTGGGATCTGCGCGGGGATCTTCAT
                  ************************************************************

HsCD00297090      CTTCTTCTTGATCAAGTACAAGCCACTCAAGTACAACAACATCTACACCTACCCAGCCTG
NM_014229.1       CTTCTTCTTGATCAAGTACAAGCCACTCAAGTACAACAACATCTACACCTACCCAGCCTG
                  ************************************************************

HsCD00297090      GGGCTATGGCATTGGCTGGCTCATGGCCCTGTCCTCCATGCTCTGCATCCCGCTCTGGAT
NM_014229.1       GGGCTATGGCATTGGCTGGCTCATGGCCCTGTCCTCCATGCTCTGCATCCCGCTCTGGAT
                  ************************************************************

HsCD00297090      CTGCATCACAGTGTGGAAGACGGAGGGGACACTGCCCGAGAAACTCCAGAAGTTGACGAC
NM_014229.1       CTGCATCACAGTGTGGAAGACGGAGGGGACACTGCCCGAGAAACTCCAGAAGTTGACGAC
                  ************************************************************

HsCD00297090      CCCCAGCACAGATCTGAAAATGCGGGGCAAGCTTGGGGTGAGCCCACGGATGGTGACAGT
NM_014229.1       CCCCAGCACAGATCTGAAAATGCGGGGCAAGCTTGGGGTGAGCCCACGGATGGTGACAGT
                  ************************************************************

HsCD00297090      TAATGACTGTGATGCCAAACTCAAGAGTGACGGGACCATCGCAGCCATCACAGAGAAGGA
NM_014229.1       TAATGACTGTGATGCCAAACTCAAGAGTGACGGGACCATCGCAGCCATCACAGAGAAGGA
                  ************************************************************

HsCD00297090      GACGCACTTCTCAGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_014229.1       GACGCACTTCTGA---------------------------
                  *********** *                           

Pathways

Reactome : Amine compound SLC transporters
Reactome : Creatine metabolism
Reactome : GABA synthesis, release, reuptake and degradation
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Na+/Cl- dependent neurotransmitter transporters
Reactome : Neuronal System
Reactome : Neurotransmitter Release Cycle
Reactome : Reuptake of GABA
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
Reactome : Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds

Protein

UniProt : P48066
HPRD : 06406

Clone

Cloning Information : 269762
HIP Master Clone ID : 201264
IMAGE ID : 100015998
Original Clone ID : FLH269762.01L

Organism


TAX_ID : 9606
Species Specific ID: 6538

Genome

Chromosome : 3
Map Location : 3p25.3

Reagents

Labome : GAT-3-antibody