DNASU Plasmid Repository • 480.965.5697 | Email

ARHGEF12 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARHGEF12
Gene Name:  Rho guanine nucleotide exchange factor (GEF) 12
Sequence             
Original Clone ID: FLH269773.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00297101

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 4632nts         Open reading frame : 35 to 4666
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGTGGCACACAGTCTACTATCAC
CGACAGGTTTCCCCTCAAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACC
AACAGATAAGAAGCAGAAAGTTGAGCGCATTGCATCACATGATTTTGACCCCACAGATAG
CTCCTCCAAGAAGACAAAGTCTAGTTCAGAGGAGAGTAGATCCGAGATATATGGTCTTGT
TCAGCGTTGCGTAATCATCCAGAAAGATGACAATGGATTTGGGCTGACGGTCAGTGGAGA
CAATCCAGTCTTCGTACAGTCTGTCAAAGAAGATGGAGCAGCCATGCGGGCTGGAGTACA
GACAGGTGATCGAATCATCAAGGTGAATGGAACTCTGGTGACTCATTCAAATCATCTGGA
GGTGGTGAAGCTAATCAAATCTGGTTCCTATGTAGCTCTCACTGTTCAGGGACGCCCACC
TGGGTCGCCCCAGATTCCACTTGCCGACTCTGAAGTAGAGCCGTCAGTCATTGGACATAT
GTCTCCCATCATGACATCTCCTCATTCACCTGGAGCATCTGGGAATATGGAGAGAATCAC
TAGTCCTGTGCTCATGGGGGAGGAAAACAATGTGGTTCATAACCAGAAAGTAGAAATTCT
GAGAAAAATGTTACAGAAAGAACAGGAACGGCTACAGTTATTGCAGGAAGATTACAACCG
AACACCTGCCCAAAGATTGCTAAAAGAGATCCAAGAGGCCAAGAAACACATTCCTCAGCT
GCAAGAGCAGTTATCCAAAGCCACAGGCTCTGCTCAGGATGGAGCTGTAGTTACACCCTC
CAGACCTTTAGGGGACACCCTAACAGTCAGTGAGGCAGAAACAGATCCTGGAGATGTACT
GGGCAGGACTGACTGTAGCAGTGGAGATGCTTCTCGGCCCAGTAGTGACAATGCAGATAG
TCCCAAGAGTGGCCCAAAAGAGAGAATTTATCTAGAGGAAAACCCAGAGAAAAGTGAAAC
AATTCAGGACACTGACACTCAATCACTTGTCGGAAGTCCCTCAACCCGTATAGCACCTCA
TATTATTGGAGCAGAAGATGATGATTTTGGTACTGAACATGAACAGATCAATGGACAGTG
CAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTT
ACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCT
GTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTT
TCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGA
AAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCA
AGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTAT
GGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACAAGGACCG
ATTGACTTTGGAGAAGGAGCGGACATGTGCAGAACAGATTGTTGCCAAAATTGAAGAAGT
ATTGATGACTGCTCAGGCTGTAGAGGAAGATAAGAGCTCCACCATGCAGTATGTTATTCT
CATGTATATGAAGCATTTGGGAGTAAAAGTGAAAGAGCCTCGAAATTTGGAGCACAAACG
GGGTCGGATTGGATTTCTTCCCAAAATCAAGCAAAGTATGAAGAAAGATAAAGAAGGGGA
AGAAAAAGGGAAGCGAAGAGGATTCCCCAGCATCCTGGGACCCCCACGGAGACCAAGCCG
TCATGACAACAGTGCAATTGGCAGAGCCATGGAACTACAGAAGGCGCGCCACCCTAAGCA
CTTATCCACACCCTCATCTGTGAGTCCTGAACCTCAGGACTCTGCCAAGTTGCGCCAGAG
TGGGTTAGCAAATGAAGGAACAGACGCTGGATACCTGCCTGCCAATTCCATGTCTTCTGT
AGCTTCAGGGGCCTCTTTTTCCCAGGAAGGAGGGAAAGAGAATGATACAGGATCAAAGCA
AGTTGGAGAAACATCAGCACCTGGAGACACCTTAGATGGCACACCTCGTACTCTCAATAC
TGTCTTTGATTTCCCACCACCTCCATTAGACCAAGTGCAGGAGGAGGAATGTGAAGTAGA
AAGGGTGACTGAACATGGGACACCAAAGCCCTTTCGAAAGTTTGACAGTGTAGCTTTTGG
AGAAAGTCAAAGTGAGGATGAACAATTTGAAAATGACTTAGAGACAGACCCACCCAACTG
GCAGCAGCTTGTTAGTCGAGAAGTGTTACTGGGACTAAAACCTTGTGAAATCAAAAGACA
GGAAGTGATTAATGAATTGTTCTACACTGAAAGAGCTCATGTTCGAACACTGAAGGTTCT
TGATCAAGTGTTCTATCAGCGAGTATCCAGAGAAGGAATTCTGTCACCCTCAGAGCTACG
GAAAATTTTTTCAAACTTGGAAGATATTCTTCAACTTCATATTGGATTGAATGAACAAAT
GAAGGCTGTTCGAAAGAGAAATGAGACCTCTGTTATCGATCAGATTGGGGAAGATTTGCT
GACATGGTTCAGCGGACCAGGAGAGGAGAAATTGAAACATGCTGCTGCTACCTTTTGCAG
TAACCAACCTTTCGCCCTGGAAATGATCAAATCTCGTCAGAAAAAGGATTCTCGATTTCA
GACTTTTGTGCAAGATGCTGAAAGTAATCCACTGTGTCGTCGTCTTCAACTGAAGGATAT
TATTCCCACTCAAATGCAAAGGCTTACTAAGTACCCACTTCTGTTGGATAATATTGCCAA
ATACACAGAATGGCCAACAGAAAGGGAGAAGGTGAAGAAAGCTGCAGATCACTGTCGTCA
GATCTTAAATTATGTAAATCAGGCTGTCAAGGAGGCAGAAAACAAGCAGCGCCTAGAAGA
TTATCAGCGTCGCCTTGATACCTCCAGCCTGAAGTTGTCAGAGTACCCAAATGTTGAAGA
GCTCAGGAATTTGGATTTAACAAAAAGGAAGATGATTCATGAAGGGCCATTGGTTTGGAA
GGTGAATAGAGATAAAACTATTGATTTATACACGTTGCTGCTGGAAGACATTCTTGTATT
GTTACAAAAGCAGGATGATAGACTGGTTTTAAGGTGTCATAGTAAGATTCTGGCATCTAC
AGCTGATAGCAAACACACGTTTAGCCCTGTCATTAAGTTGAGTACAGTGTTGGTTCGACA
AGTGGCAACAGATAACAAAGCTTTATTCGTCATTTCCATGTCAGACAATGGCGCTCAGAT
TTATGAACTGGTGGCACAGACAGTTTCTGAAAAGACTGTCTGGCAGGACCTAATCTGTCG
GATGGCTGCATCAGTGAAGGAGCAATCCACAAAGCCAATTCCATTACCACAGTCAACACC
TGGCGAAGGAGATAATGATGAAGAAGATCCTTCAAAATTAAAAGAGGAGCAGCATGGCAT
TTCAGTCACTGGTTTGCAGAGTCCAGACAGAGATTTGGGATTAGAATCTACCTTAATATC
GTCAAAACCTCAGTCTCATTCACTGAGTACCTCTGGGAAATCAGAGGTACGTGATCTGTT
TGTGGCTGAGAGACAGTTTGCAAAGGAACAACATACAGATGGGACACTAAAGGAAGTTGG
AGAAGATTATCAAATCGCAATCCCAGATTCACACCTGCCTGTCTCAGAAGAACGGTGGGC
ATTGGATGCACTAAGAAATTTGGGTTTGTTGAAGCAGTTGCTGGTGCAACAGCTAGGTTT
GACTGAGAAGAGCGTTCAGGAAGACTGGCAACATTTCCCAAGATACAGAACAGCCTCTCA
GGGGCCGCAGACAGACAGTGTCATCCAGAACTCTGAAAATATTAAGGCCTATCATTCTGG
TGAAGGACATATGCCCTTTAGAACTGGAACTGGTGACATTGCAACTTGTTACAGTCCACG
GACTTCAACTGAATCTTTTGCTCCACGGGATTCAGTGGGACTGGCACCCCAGGATAGCCA
GGCAAGTAACATTTTAGTAATGGACCACATGATTATGACCCCAGAGATGCCTACCATGGA
GCCAGAAGGGGGTCTTGATGACAGTGGAGAGCACTTTTTTGATGCCCGTGAAGCACATAG
TGATGAGAATCCATCAGAAGGTGATGGAGCAGTTAACAAGGAAGAGAAGGATGTTAATTT
ACGCATCTCAGGAAACTATTTGATCCTTGATGGCTATGACCCAGTGCAGGAGAGTTCCAC
AGATGAGGAGGTTGCTTCCTCACTTACCCTGCAGCCCATGACAGGCATCCCTGCTGTGGA
ATCCACCCACCAGCAGCAACATTCTCCTCAGAATACTCACTCCGATGGGGCAATTTCACC
ATTCACCCCCGAATTTCTGGTCCAGCAGCGCTGGGGAGCTATGGAGTATTCCTGTTTTGA
GATCCAGAGTCCCTCCTCTTGTGCAGATTCACAGAGCCAGATCATGGAGTACATTCATAA
GATAGAGGCTGACCTTGAACACTTAAAGAAGGTGGAGGAAAGTTACACCATTCTTTGCCA
AAGGCTGGCTGGATCAGCCCTCACAGACAAGCACTCAGATAAAAGTTCAGGCCTCATGGG
CCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 8
End on reference sequence 4642
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARHGEF12
Symbol Nomenclature : ARHGEF12
SYNONYM : LARG; PRO2792
Designation : leukemia-associated RhoGEF|leukemia-associated rho guanine nucleotide exchange factor|rho guanine nucleotide exchange factor 12
Full Nomenclature : Rho guanine nucleotide exchange factor (GEF) 12
GENEID : 23365
GI : 157169595
GenBank Accession : BC152900
HGNC : 14193
MIM : 604763
Vega : OTTHUMG00000166143
Target GenBank: NM_015313.1

 

Reference Sequence Alignment

  

HsCD00297101        GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAGTGGCACACAGTCTACTATCAC
NM_001198665.1      ----------------------------------ATGAGTGGCACACAGTCTACTATCAC
NM_015313.2         ----------------------------------ATGAGTGGCACACAGTCTACTATCAC
                                                      **************************

HsCD00297101        CGACAGGTTTCCCCTCAAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACC
NM_001198665.1      CGACAGGTTTCCCCTCAAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACC
NM_015313.2         CGACAGGTTTCCCCTCAAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACC
                    ************************************************************

HsCD00297101        AACAGATAAGAAGCAGAAAGTTGAGCGCATTGCATCACATGATTTTGACCCCACAGATAG
NM_001198665.1      AACAGATAAGAAGCAGAAAGTTGAGCGCATTGCATCACATGATTTTGACCCCACAGG---
NM_015313.2         AACAGATAAGAAGCAGAAAGTTGAGCGCATTGCATCACATGATTTTGACCCCACAGATAG
                    ********************************************************.   

HsCD00297101        CTCCTCCAAGAAGACAAAGTCTAGTTCAGAGGAGAGTAGATCCGAGATATATGGTCTTGT
NM_001198665.1      ------------------------------------------------------TCTTGT
NM_015313.2         CTCCTCCAAGAAGACAAAGTCTAGTTCAGAGGAGAGTAGATCCGAGATATATGGTCTTGT
                                                                          ******

HsCD00297101        TCAGCGTTGCGTAATCATCCAGAAAGATGACAATGGATTTGGGCTGACGGTCAGTGGAGA
NM_001198665.1      TCAGCGTTGCGTAATCATCCAGAAAGATGACAATGGATTTGGGCTGACGGTCAGTGGAGA
NM_015313.2         TCAGCGTTGCGTAATCATCCAGAAAGATGACAATGGATTTGGGCTGACGGTCAGTGGAGA
                    ************************************************************

HsCD00297101        CAATCCAGTCTTCGTACAGTCTGTCAAAGAAGATGGAGCAGCCATGCGGGCTGGAGTACA
NM_001198665.1      CAATCCAGTCTTCGTACAGTCTGTCAAAGAAGATGGAGCAGCCATGCGGGCTGGAGTACA
NM_015313.2         CAATCCAGTCTTCGTACAGTCTGTCAAAGAAGATGGAGCAGCCATGCGGGCTGGAGTACA
                    ************************************************************

HsCD00297101        GACAGGTGATCGAATCATCAAGGTGAATGGAACTCTGGTGACTCATTCAAATCATCTGGA
NM_001198665.1      GACAGGTGATCGAATCATCAAGGTGAATGGAACTCTGGTGACTCATTCAAATCATCTGGA
NM_015313.2         GACAGGTGATCGAATCATCAAGGTGAATGGAACTCTGGTGACTCATTCAAATCATCTGGA
                    ************************************************************

HsCD00297101        GGTGGTGAAGCTAATCAAATCTGGTTCCTATGTAGCTCTCACTGTTCAGGGACGCCCACC
NM_001198665.1      GGTGGTGAAGCTAATCAAATCTGGTTCCTATGTAGCTCTCACTGTTCAGGGACGCCCACC
NM_015313.2         GGTGGTGAAGCTAATCAAATCTGGTTCCTATGTAGCTCTCACTGTTCAGGGACGCCCACC
                    ************************************************************

HsCD00297101        TGGGTCGCCCCAGATTCCACTTGCCGACTCTGAAGTAGAGCCGTCAGTCATTGGACATAT
NM_001198665.1      TGGGTCGCCCCAGATTCCACTTGCCGACTCTGAAGTAGAGCCGTCAGTCATTGGACATAT
NM_015313.2         TGGGTCGCCCCAGATTCCACTTGCCGACTCTGAAGTAGAGCCGTCAGTCATTGGACATAT
                    ************************************************************

HsCD00297101        GTCTCCCATCATGACATCTCCTCATTCACCTGGAGCATCTGGGAATATGGAGAGAATCAC
NM_001198665.1      GTCTCCCATCATGACATCTCCTCATTCACCTGGAGCATCTGGGAATATGGAGAGAATCAC
NM_015313.2         GTCTCCCATCATGACATCTCCTCATTCACCTGGAGCATCTGGGAATATGGAGAGAATCAC
                    ************************************************************

HsCD00297101        TAGTCCTGTGCTCATGGGGGAGGAAAACAATGTGGTTCATAACCAGAAAGTAGAAATTCT
NM_001198665.1      TAGTCCTGTGCTCATGGGGGAGGAAAACAATGTGGTTCATAACCAGAAAGTAGAAATTCT
NM_015313.2         TAGTCCTGTGCTCATGGGGGAGGAAAACAATGTGGTTCATAACCAGAAAGTAGAAATTCT
                    ************************************************************

HsCD00297101        GAGAAAAATGTTACAGAAAGAACAGGAACGGCTACAGTTATTGCAGGAAGATTACAACCG
NM_001198665.1      GAGAAAAATGTTACAGAAAGAACAGGAACGGCTACAGTTATTGCAGGAAGATTACAACCG
NM_015313.2         GAGAAAAATGTTACAGAAAGAACAGGAACGGCTACAGTTATTGCAGGAAGATTACAACCG
                    ************************************************************

HsCD00297101        AACACCTGCCCAAAGATTGCTAAAAGAGATCCAAGAGGCCAAGAAACACATTCCTCAGCT
NM_001198665.1      AACACCTGCCCAAAGATTGCTAAAAGAGATCCAAGAGGCCAAGAAACACATTCCTCAGCT
NM_015313.2         AACACCTGCCCAAAGATTGCTAAAAGAGATCCAAGAGGCCAAGAAACACATTCCTCAGCT
                    ************************************************************

HsCD00297101        GCAAGAGCAGTTATCCAAAGCCACAGGCTCTGCTCAGGATGGAGCTGTAGTTACACCCTC
NM_001198665.1      GCAAGAGCAGTTATCCAAAGCCACAGGCTCTGCTCAGGATGGAGCTGTAGTTACACCCTC
NM_015313.2         GCAAGAGCAGTTATCCAAAGCCACAGGCTCTGCTCAGGATGGAGCTGTAGTTACACCCTC
                    ************************************************************

HsCD00297101        CAGACCTTTAGGGGACACCCTAACAGTCAGTGAGGCAGAAACAGATCCTGGAGATGTACT
NM_001198665.1      CAGACCTTTAGGGGACACCCTAACAGTCAGTGAGGCAGAAACAGATCCTGGAGATGTACT
NM_015313.2         CAGACCTTTAGGGGACACCCTAACAGTCAGTGAGGCAGAAACAGATCCTGGAGATGTACT
                    ************************************************************

HsCD00297101        GGGCAGGACTGACTGTAGCAGTGGAGATGCTTCTCGGCCCAGTAGTGACAATGCAGATAG
NM_001198665.1      GGGCAGGACTGACTGTAGCAGTGGAGATGCTTCTCGGCCCAGTAGTGACAATGCAGATAG
NM_015313.2         GGGCAGGACTGACTGTAGCAGTGGAGATGCTTCTCGGCCCAGTAGTGACAATGCAGATAG
                    ************************************************************

HsCD00297101        TCCCAAGAGTGGCCCAAAAGAGAGAATTTATCTAGAGGAAAACCCAGAGAAAAGTGAAAC
NM_001198665.1      TCCCAAGAGTGGCCCAAAAGAGAGAATTTATCTAGAGGAAAACCCAGAGAAAAGTGAAAC
NM_015313.2         TCCCAAGAGTGGCCCAAAAGAGAGAATTTATCTAGAGGAAAACCCAGAGAAAAGTGAAAC
                    ************************************************************

HsCD00297101        AATTCAGGACACTGACACTCAATCACTTGTCGGAAGTCCCTCAACCCGTATAGCACCTCA
NM_001198665.1      AATTCAGGACACTGACACTCAATCACTTGTCGGAAGTCCCTCAACCCGTATAGCACCTCA
NM_015313.2         AATTCAGGACACTGACACTCAATCACTTGTCGGAAGTCCCTCAACCCGTATAGCACCTCA
                    ************************************************************

HsCD00297101        TATTATTGGAGCAGAAGATGATGATTTTGGTACTGAACATGAACAGATCAATGGACAGTG
NM_001198665.1      TATTATTGGAGCAGAAGATGATGATTTTGGTACTGAACATGAACAGATCAATGGACAGTG
NM_015313.2         TATTATTGGAGCAGAAGATGATGATTTTGGTACTGAACATGAACAGATCAATGGACAGTG
                    ************************************************************

HsCD00297101        CAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTT
NM_001198665.1      CAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTT
NM_015313.2         CAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTT
                    ************************************************************

HsCD00297101        ACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCT
NM_001198665.1      ACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCT
NM_015313.2         ACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCT
                    ************************************************************

HsCD00297101        GTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTT
NM_001198665.1      GTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTT
NM_015313.2         GTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTT
                    ************************************************************

HsCD00297101        TCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGA
NM_001198665.1      TCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGA
NM_015313.2         TCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGA
                    ************************************************************

HsCD00297101        AAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCA
NM_001198665.1      AAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCA
NM_015313.2         AAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCA
                    ************************************************************

HsCD00297101        AGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTAT
NM_001198665.1      AGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTAT
NM_015313.2         AGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTAT
                    ************************************************************

HsCD00297101        GGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACAAGGACCG
NM_001198665.1      GGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACAAGGACCG
NM_015313.2         GGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACAAGGACCG
                    ************************************************************

HsCD00297101        ATTGACTTTGGAGAAGGAGCGGACATGTGCAGAACAGATTGTTGCCAAAATTGAAGAAGT
NM_001198665.1      ATTGACTTTGGAGAAGGAGCGGACATGTGCAGAACAGATTGTTGCCAAAATTGAAGAAGT
NM_015313.2         ATTGACTTTGGAGAAGGAGCGGACATGTGCAGAACAGATTGTTGCCAAAATTGAAGAAGT
                    ************************************************************

HsCD00297101        ATTGATGACTGCTCAGGCTGTAGAGGAAGATAAGAGCTCCACCATGCAGTATGTTATTCT
NM_001198665.1      ATTGATGACTGCTCAGGCTGTAGAGGAAGATAAGAGCTCCACCATGCAGTATGTTATTCT
NM_015313.2         ATTGATGACTGCTCAGGCTGTAGAGGAAGATAAGAGCTCCACCATGCAGTATGTTATTCT
                    ************************************************************

HsCD00297101        CATGTATATGAAGCATTTGGGAGTAAAAGTGAAAGAGCCTCGAAATTTGGAGCACAAACG
NM_001198665.1      CATGTATATGAAGCATTTGGGAGTAAAAGTGAAAGAGCCTCGAAATTTGGAGCACAAACG
NM_015313.2         CATGTATATGAAGCATTTGGGAGTAAAAGTGAAAGAGCCTCGAAATTTGGAGCACAAACG
                    ************************************************************

HsCD00297101        GGGTCGGATTGGATTTCTTCCCAAAATCAAGCAAAGTATGAAGAAAGATAAAGAAGGGGA
NM_001198665.1      GGGTCGGATTGGATTTCTTCCCAAAATCAAGCAAAGTATGAAGAAAGATAAAGAAGGGGA
NM_015313.2         GGGTCGGATTGGATTTCTTCCCAAAATCAAGCAAAGTATGAAGAAAGATAAAGAAGGGGA
                    ************************************************************

HsCD00297101        AGAAAAAGGGAAGCGAAGAGGATTCCCCAGCATCCTGGGACCCCCACGGAGACCAAGCCG
NM_001198665.1      AGAAAAAGGGAAGCGAAGAGGATTCCCCAGCATCCTGGGACCCCCACGGAGACCAAGCCG
NM_015313.2         AGAAAAAGGGAAGCGAAGAGGATTCCCCAGCATCCTGGGACCCCCACGGAGACCAAGCCG
                    ************************************************************

HsCD00297101        TCATGACAACAGTGCAATTGGCAGAGCCATGGAACTACAGAAGGCGCGCCACCCTAAGCA
NM_001198665.1      TCATGACAACAGTGCAATTGGCAGAGCCATGGAACTACAGAAGGCGCGCCACCCTAAGCA
NM_015313.2         TCATGACAACAGTGCAATTGGCAGAGCCATGGAACTACAGAAGGCGCGCCACCCTAAGCA
                    ************************************************************

HsCD00297101        CTTATCCACACCCTCATCTGTGAGTCCTGAACCTCAGGACTCTGCCAAGTTGCGCCAGAG
NM_001198665.1      CTTATCCACACCCTCATCTGTGAGTCCTGAACCTCAGGACTCTGCCAAGTTGCGCCAGAG
NM_015313.2         CTTATCCACACCCTCATCTGTGAGTCCTGAACCTCAGGACTCTGCCAAGTTGCGCCAGAG
                    ************************************************************

HsCD00297101        TGGGTTAGCAAATGAAGGAACAGACGCTGGATACCTGCCTGCCAATTCCATGTCTTCTGT
NM_001198665.1      TGGGTTAGCAAATGAAGGAACAGACGCTGGATACCTGCCTGCCAATTCCATGTCTTCTGT
NM_015313.2         TGGGTTAGCAAATGAAGGAACAGACGCTGGATACCTGCCTGCCAATTCCATGTCTTCTGT
                    ************************************************************

HsCD00297101        AGCTTCAGGGGCCTCTTTTTCCCAGGAAGGAGGGAAAGAGAATGATACAGGATCAAAGCA
NM_001198665.1      AGCTTCAGGGGCCTCTTTTTCCCAGGAAGGAGGGAAAGAGAATGATACAGGATCAAAGCA
NM_015313.2         AGCTTCAGGGGCCTCTTTTTCCCAGGAAGGAGGGAAAGAGAATGATACAGGATCAAAGCA
                    ************************************************************

HsCD00297101        AGTTGGAGAAACATCAGCACCTGGAGACACCTTAGATGGCACACCTCGTACTCTCAATAC
NM_001198665.1      AGTTGGAGAAACATCAGCACCTGGAGACACCTTAGATGGCACACCTCGTACTCTCAATAC
NM_015313.2         AGTTGGAGAAACATCAGCACCTGGAGACACCTTAGATGGCACACCTCGTACTCTCAATAC
                    ************************************************************

HsCD00297101        TGTCTTTGATTTCCCACCACCTCCATTAGACCAAGTGCAGGAGGAGGAATGTGAAGTAGA
NM_001198665.1      TGTCTTTGATTTCCCACCACCTCCATTAGACCAAGTGCAGGAGGAGGAATGTGAAGTAGA
NM_015313.2         TGTCTTTGATTTCCCACCACCTCCATTAGACCAAGTGCAGGAGGAGGAATGTGAAGTAGA
                    ************************************************************

HsCD00297101        AAGGGTGACTGAACATGGGACACCAAAGCCCTTTCGAAAGTTTGACAGTGTAGCTTTTGG
NM_001198665.1      AAGGGTGACTGAACATGGGACACCAAAGCCCTTTCGAAAGTTTGACAGTGTAGCTTTTGG
NM_015313.2         AAGGGTGACTGAACATGGGACACCAAAGCCCTTTCGAAAGTTTGACAGTGTAGCTTTTGG
                    ************************************************************

HsCD00297101        AGAAAGTCAAAGTGAGGATGAACAATTTGAAAATGACTTAGAGACAGACCCACCCAACTG
NM_001198665.1      AGAAAGTCAAAGTGAGGATGAACAATTTGAAAATGACTTAGAGACAGATCCACCCAACTG
NM_015313.2         AGAAAGTCAAAGTGAGGATGAACAATTTGAAAATGACTTAGAGACAGATCCACCCAACTG
                    ************************************************ ***********

HsCD00297101        GCAGCAGCTTGTTAGTCGAGAAGTGTTACTGGGACTAAAACCTTGTGAAATCAAAAGACA
NM_001198665.1      GCAGCAGCTTGTTAGTCGAGAAGTGTTACTGGGACTAAAACCTTGTGAAATCAAAAGACA
NM_015313.2         GCAGCAGCTTGTTAGTCGAGAAGTGTTACTGGGACTAAAACCTTGTGAAATCAAAAGACA
                    ************************************************************

HsCD00297101        GGAAGTGATTAATGAATTGTTCTACACTGAAAGAGCTCATGTTCGAACACTGAAGGTTCT
NM_001198665.1      GGAAGTGATTAATGAATTGTTCTACACTGAAAGAGCTCATGTTCGAACACTGAAGGTTCT
NM_015313.2         GGAAGTGATTAATGAATTGTTCTACACTGAAAGAGCTCATGTTCGAACACTGAAGGTTCT
                    ************************************************************

HsCD00297101        TGATCAAGTGTTCTATCAGCGAGTATCCAGAGAAGGAATTCTGTCACCCTCAGAGCTACG
NM_001198665.1      TGATCAAGTGTTCTATCAGCGAGTATCCAGAGAAGGAATTCTGTCACCCTCAGAGCTACG
NM_015313.2         TGATCAAGTGTTCTATCAGCGAGTATCCAGAGAAGGAATTCTGTCACCCTCAGAGCTACG
                    ************************************************************

HsCD00297101        GAAAATTTTTTCAAACTTGGAAGATATTCTTCAACTTCATATTGGATTGAATGAACAAAT
NM_001198665.1      GAAAATTTTTTCAAACTTGGAAGATATTCTTCAACTTCATATTGGATTGAATGAACAAAT
NM_015313.2         GAAAATTTTTTCAAACTTGGAAGATATTCTTCAACTTCATATTGGATTGAATGAACAAAT
                    ************************************************************

HsCD00297101        GAAGGCTGTTCGAAAGAGAAATGAGACCTCTGTTATCGATCAGATTGGGGAAGATTTGCT
NM_001198665.1      GAAGGCTGTTCGAAAGAGAAATGAGACCTCTGTTATCGATCAGATTGGGGAAGATTTGCT
NM_015313.2         GAAGGCTGTTCGAAAGAGAAATGAGACCTCTGTTATCGATCAGATTGGGGAAGATTTGCT
                    ************************************************************

HsCD00297101        GACATGGTTCAGCGGACCAGGAGAGGAGAAATTGAAACATGCTGCTGCTACCTTTTGCAG
NM_001198665.1      GACATGGTTCAGCGGACCAGGAGAGGAGAAATTGAAACATGCTGCTGCTACCTTTTGCAG
NM_015313.2         GACATGGTTCAGCGGACCAGGAGAGGAGAAATTGAAACATGCTGCTGCTACCTTTTGCAG
                    ************************************************************

HsCD00297101        TAACCAACCTTTCGCCCTGGAAATGATCAAATCTCGTCAGAAAAAGGATTCTCGATTTCA
NM_001198665.1      TAACCAACCTTTCGCCCTGGAAATGATCAAATCTCGTCAGAAAAAGGATTCTCGATTTCA
NM_015313.2         TAACCAACCTTTCGCCCTGGAAATGATCAAATCTCGTCAGAAAAAGGATTCTCGATTTCA
                    ************************************************************

HsCD00297101        GACTTTTGTGCAAGATGCTGAAAGTAATCCACTGTGTCGTCGTCTTCAACTGAAGGATAT
NM_001198665.1      GACTTTTGTGCAAGATGCTGAAAGTAATCCACTGTGTCGTCGTCTTCAACTGAAGGATAT
NM_015313.2         GACTTTTGTGCAAGATGCTGAAAGTAATCCACTGTGTCGTCGTCTTCAACTGAAGGATAT
                    ************************************************************

HsCD00297101        TATTCCCACTCAAATGCAAAGGCTTACTAAGTACCCACTTCTGTTGGATAATATTGCCAA
NM_001198665.1      TATTCCCACTCAAATGCAAAGGCTTACTAAGTACCCACTTCTGTTGGATAATATTGCCAA
NM_015313.2         TATTCCCACTCAAATGCAAAGGCTTACTAAGTACCCACTTCTGTTGGATAATATTGCCAA
                    ************************************************************

HsCD00297101        ATACACAGAATGGCCAACAGAAAGGGAGAAGGTGAAGAAAGCTGCAGATCACTGTCGTCA
NM_001198665.1      ATACACAGAATGGCCAACAGAAAGGGAGAAGGTGAAGAAAGCTGCAGATCACTGTCGTCA
NM_015313.2         ATACACAGAATGGCCAACAGAAAGGGAGAAGGTGAAGAAAGCTGCAGATCACTGTCGTCA
                    ************************************************************

HsCD00297101        GATCTTAAATTATGTAAATCAGGCTGTCAAGGAGGCAGAAAACAAGCAGCGCCTAGAAGA
NM_001198665.1      GATCTTAAATTATGTAAATCAGGCTGTCAAGGAGGCAGAAAACAAGCAGCGCCTAGAAGA
NM_015313.2         GATCTTAAATTATGTAAATCAGGCTGTCAAGGAGGCAGAAAACAAGCAGCGCCTAGAAGA
                    ************************************************************

HsCD00297101        TTATCAGCGTCGCCTTGATACCTCCAGCCTGAAGTTGTCAGAGTACCCAAATGTTGAAGA
NM_001198665.1      TTATCAGCGTCGCCTTGATACCTCCAGCCTGAAGTTGTCAGAGTACCCAAATGTTGAAGA
NM_015313.2         TTATCAGCGTCGCCTTGATACCTCCAGCCTGAAGTTGTCAGAGTACCCAAATGTTGAAGA
                    ************************************************************

HsCD00297101        GCTCAGGAATTTGGATTTAACAAAAAGGAAGATGATTCATGAAGGGCCATTGGTTTGGAA
NM_001198665.1      GCTCAGGAATTTGGATTTAACAAAAAGGAAGATGATTCATGAAGGGCCATTGGTTTGGAA
NM_015313.2         GCTCAGGAATTTGGATTTAACAAAAAGGAAGATGATTCATGAAGGGCCATTGGTTTGGAA
                    ************************************************************

HsCD00297101        GGTGAATAGAGATAAAACTATTGATTTATACACGTTGCTGCTGGAAGACATTCTTGTATT
NM_001198665.1      GGTGAATAGAGATAAAACTATTGATTTATACACGTTGCTGCTGGAAGACATTCTTGTATT
NM_015313.2         GGTGAATAGAGATAAAACTATTGATTTATACACGTTGCTGCTGGAAGACATTCTTGTATT
                    ************************************************************

HsCD00297101        GTTACAAAAGCAGGATGATAGACTGGTTTTAAGGTGTCATAGTAAGATTCTGGCATCTAC
NM_001198665.1      GTTACAAAAGCAGGATGATAGACTGGTTTTAAGGTGTCATAGTAAGATTCTGGCATCTAC
NM_015313.2         GTTACAAAAGCAGGATGATAGACTGGTTTTAAGGTGTCATAGTAAGATTCTGGCATCTAC
                    ************************************************************

HsCD00297101        AGCTGATAGCAAACACACGTTTAGCCCTGTCATTAAGTTGAGTACAGTGTTGGTTCGACA
NM_001198665.1      AGCTGATAGCAAACACACGTTTAGCCCTGTCATTAAGTTGAGTACAGTGTTGGTTCGACA
NM_015313.2         AGCTGATAGCAAACACACGTTTAGCCCTGTCATTAAGTTGAGTACAGTGTTGGTTCGACA
                    ************************************************************

HsCD00297101        AGTGGCAACAGATAACAAAGCTTTATTCGTCATTTCCATGTCAGACAATGGCGCTCAGAT
NM_001198665.1      AGTGGCAACAGATAACAAAGCTTTATTCGTCATTTCCATGTCAGACAATGGCGCTCAGAT
NM_015313.2         AGTGGCAACAGATAACAAAGCTTTATTCGTCATTTCCATGTCAGACAATGGCGCTCAGAT
                    ************************************************************

HsCD00297101        TTATGAACTGGTGGCACAGACAGTTTCTGAAAAGACTGTCTGGCAGGACCTAATCTGTCG
NM_001198665.1      TTATGAACTGGTGGCACAGACAGTTTCTGAAAAGACTGTCTGGCAGGACCTAATCTGTCG
NM_015313.2         TTATGAACTGGTGGCACAGACAGTTTCTGAAAAGACTGTCTGGCAGGACCTAATCTGTCG
                    ************************************************************

HsCD00297101        GATGGCTGCATCAGTGAAGGAGCAATCCACAAAGCCAATTCCATTACCACAGTCAACACC
NM_001198665.1      GATGGCTGCATCAGTGAAGGAGCAATCCACAAAGCCAATTCCATTACCACAGTCAACACC
NM_015313.2         GATGGCTGCATCAGTGAAGGAGCAATCCACAAAGCCAATTCCATTACCACAGTCAACACC
                    ************************************************************

HsCD00297101        TGGCGAAGGAGATAATGATGAAGAAGATCCTTCAAAATTAAAAGAGGAGCAGCATGGCAT
NM_001198665.1      TGGCGAAGGAGATAATGATGAAGAAGATCCTTCAAAATTAAAAGAGGAGCAGCATGGCAT
NM_015313.2         TGGCGAAGGAGATAATGATGAAGAAGATCCTTCAAAATTAAAAGAGGAGCAGCATGGCAT
                    ************************************************************

HsCD00297101        TTCAGTCACTGGTTTGCAGAGTCCAGACAGAGATTTGGGATTAGAATCTACCTTAATATC
NM_001198665.1      TTCAGTCACTGGTTTGCAGAGTCCAGACAGAGATTTGGGATTAGAATCTACCTTAATATC
NM_015313.2         TTCAGTCACTGGTTTGCAGAGTCCAGACAGAGATTTGGGATTAGAATCTACCTTAATATC
                    ************************************************************

HsCD00297101        GTCAAAACCTCAGTCTCATTCACTGAGTACCTCTGGGAAATCAGAGGTACGTGATCTGTT
NM_001198665.1      GTCAAAACCTCAGTCTCATTCACTGAGTACCTCTGGGAAATCAGAGGTACGTGATCTGTT
NM_015313.2         GTCAAAACCTCAGTCTCATTCACTGAGTACCTCTGGGAAATCAGAGGTACGTGATCTGTT
                    ************************************************************

HsCD00297101        TGTGGCTGAGAGACAGTTTGCAAAGGAACAACATACAGATGGGACACTAAAGGAAGTTGG
NM_001198665.1      TGTGGCTGAGAGACAGTTTGCAAAGGAACAACATACAGATGGGACACTAAAGGAAGTTGG
NM_015313.2         TGTGGCTGAGAGACAGTTTGCAAAGGAACAACATACAGATGGGACACTAAAGGAAGTTGG
                    ************************************************************

HsCD00297101        AGAAGATTATCAAATCGCAATCCCAGATTCACACCTGCCTGTCTCAGAAGAACGGTGGGC
NM_001198665.1      AGAAGATTATCAAATCGCAATCCCAGATTCACACCTGCCTGTCTCAGAAGAACGGTGGGC
NM_015313.2         AGAAGATTATCAAATCGCAATCCCAGATTCACACCTGCCTGTCTCAGAAGAACGGTGGGC
                    ************************************************************

HsCD00297101        ATTGGATGCACTAAGAAATTTGGGTTTGTTGAAGCAGTTGCTGGTGCAACAGCTAGGTTT
NM_001198665.1      ATTGGATGCACTAAGAAATTTGGGTTTGTTGAAGCAGTTGCTGGTGCAACAGCTAGGTTT
NM_015313.2         ATTGGATGCACTAAGAAATTTGGGTTTGTTGAAGCAGTTGCTGGTGCAACAGCTAGGTTT
                    ************************************************************

HsCD00297101        GACTGAGAAGAGCGTTCAGGAAGACTGGCAACATTTCCCAAGATACAGAACAGCCTCTCA
NM_001198665.1      GACTGAGAAGAGCGTTCAGGAAGACTGGCAACATTTCCCAAGATACAGAACAGCCTCTCA
NM_015313.2         GACTGAGAAGAGCGTTCAGGAAGACTGGCAACATTTCCCAAGATACAGAACAGCCTCTCA
                    ************************************************************

HsCD00297101        GGGGCCGCAGACAGACAGTGTCATCCAGAACTCTGAAAATATTAAGGCCTATCATTCTGG
NM_001198665.1      GGGGCCGCAGACAGACAGTGTCATCCAGAACTCTGAAAATATTAAGGCCTATCATTCTGG
NM_015313.2         GGGGCCGCAGACAGACAGTGTCATCCAGAACTCTGAAAATATTAAGGCCTATCATTCTGG
                    ************************************************************

HsCD00297101        TGAAGGACATATGCCCTTTAGAACTGGAACTGGTGACATTGCAACTTGTTACAGTCCACG
NM_001198665.1      TGAAGGACATATGCCCTTTAGAACTGGAACTGGTGACATTGCAACTTGTTACAGTCCACG
NM_015313.2         TGAAGGACATATGCCCTTTAGAACTGGAACTGGTGACATTGCAACTTGTTACAGTCCACG
                    ************************************************************

HsCD00297101        GACTTCAACTGAATCTTTTGCTCCACGGGATTCAGTGGGACTGGCACCCCAGGATAGCCA
NM_001198665.1      GACTTCAACTGAATCTTTTGCTCCACGGGATTCAGTGGGACTGGCACCCCAGGATAGCCA
NM_015313.2         GACTTCAACTGAATCTTTTGCTCCACGGGATTCAGTGGGACTGGCACCCCAGGATAGCCA
                    ************************************************************

HsCD00297101        GGCAAGTAACATTTTAGTAATGGACCACATGATTATGACCCCAGAGATGCCTACCATGGA
NM_001198665.1      GGCAAGTAACATTTTAGTAATGGACCACATGATTATGACCCCAGAGATGCCTACCATGGA
NM_015313.2         GGCAAGTAACATTTTAGTAATGGACCACATGATTATGACCCCAGAGATGCCTACCATGGA
                    ************************************************************

HsCD00297101        GCCAGAAGGGGGTCTTGATGACAGTGGAGAGCACTTTTTTGATGCCCGTGAAGCACATAG
NM_001198665.1      GCCAGAAGGGGGTCTTGATGACAGTGGAGAGCACTTTTTTGATGCCCGTGAAGCACATAG
NM_015313.2         GCCAGAAGGGGGTCTTGATGACAGTGGAGAGCACTTTTTTGATGCCCGTGAAGCACATAG
                    ************************************************************

HsCD00297101        TGATGAGAATCCATCAGAAGGTGATGGAGCAGTTAACAAGGAAGAGAAGGATGTTAATTT
NM_001198665.1      TGATGAGAATCCATCAGAAGGTGATGGAGCAGTTAACAAGGAAGAGAAGGATGTTAATTT
NM_015313.2         TGATGAGAATCCATCAGAAGGTGATGGAGCAGTTAACAAGGAAGAGAAGGATGTTAATTT
                    ************************************************************

HsCD00297101        ACGCATCTCAGGAAACTATTTGATCCTTGATGGCTATGACCCAGTGCAGGAGAGTTCCAC
NM_001198665.1      ACGCATCTCAGGAAACTATTTGATCCTTGATGGCTATGACCCAGTGCAGGAGAGTTCCAC
NM_015313.2         ACGCATCTCAGGAAACTATTTGATCCTTGATGGCTATGACCCAGTGCAGGAGAGTTCCAC
                    ************************************************************

HsCD00297101        AGATGAGGAGGTTGCTTCCTCACTTACCCTGCAGCCCATGACAGGCATCCCTGCTGTGGA
NM_001198665.1      AGATGAGGAGGTTGCTTCCTCACTTACCCTGCAGCCCATGACAGGCATCCCTGCTGTGGA
NM_015313.2         AGATGAGGAGGTTGCTTCCTCACTTACCCTGCAGCCCATGACAGGCATCCCTGCTGTGGA
                    ************************************************************

HsCD00297101        ATCCACCCACCAGCAGCAACATTCTCCTCAGAATACTCACTCCGATGGGGCAATTTCACC
NM_001198665.1      ATCCACCCACCAGCAGCAACATTCTCCTCAGAATACTCACTCCGATGGGGCAATTTCACC
NM_015313.2         ATCCACCCACCAGCAGCAACATTCTCCTCAGAATACTCACTCCGATGGGGCAATTTCACC
                    ************************************************************

HsCD00297101        ATTCACCCCCGAATTTCTGGTCCAGCAGCGCTGGGGAGCTATGGAGTATTCCTGTTTTGA
NM_001198665.1      ATTCACCCCCGAATTTCTGGTCCAGCAGCGCTGGGGAGCTATGGAGTATTCCTGTTTTGA
NM_015313.2         ATTCACCCCCGAATTTCTGGTCCAGCAGCGCTGGGGAGCTATGGAGTATTCCTGTTTTGA
                    ************************************************************

HsCD00297101        GATCCAGAGTCCCTCCTCTTGTGCAGATTCACAGAGCCAGATCATGGAGTACATTCATAA
NM_001198665.1      GATCCAGAGTCCCTCCTCTTGTGCAGATTCACAGAGCCAGATCATGGAGTACATTCATAA
NM_015313.2         GATCCAGAGTCCCTCCTCTTGTGCAGATTCACAGAGCCAGATCATGGAGTACATTCATAA
                    ************************************************************

HsCD00297101        GATAGAGGCTGACCTTGAACACTTAAAGAAGGTGGAGGAAAGTTACACCATTCTTTGCCA
NM_001198665.1      GATAGAGGCTGACCTTGAACACTTAAAGAAGGTGGAGGAAAGTTACACCATTCTTTGCCA
NM_015313.2         GATAGAGGCTGACCTTGAACACTTAAAGAAGGTGGAGGAAAGTTACACCATTCTTTGCCA
                    ************************************************************

HsCD00297101        AAGGCTGGCTGGATCAGCCCTCACAGACAAGCACTCAGATAAAAGTTCAGGCCTCATGGG
NM_001198665.1      AAGGCTGGCTGGATCAGCCCTCACAGACAAGCACTCAGATAAAAGTTAG-----------
NM_015313.2         AAGGCTGGCTGGATCAGCCCTCACAGACAAGCACTCAGATAAAAGTTAG-----------
                    ***********************************************..           

HsCD00297101        CCCAGCTTTCTTGTAC
NM_001198665.1      ----------------
NM_015313.2         ----------------
                                    

Pathways

NCI : Regulation of RhoA activity
Reactome : Axon guidance
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Developmental Biology
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : NRAGE signals death through JNK
Reactome : Rho GTPase cycle
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D induced cell migration and growth-cone collapse
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling

Clone

Cloning Information : 269773
HIP Master Clone ID : 201275
IMAGE ID : 100016177
Original Clone ID : FLH269773.01L

Organism


TAX_ID : 9606
Species Specific ID: 23365

Genome

Chromosome : 11
Map Location : 11q23.3
Ensembl : ENSG00000196914

Reagents

Labome : ARHGEF12-antibody