DNASU Plasmid Repository • 480.965.5697 | Email

FOXP1 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FOXP1
Gene Name:  forkhead box P1
Sequence             
Original Clone ID: FLH269777.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 25027557
Title: Transcriptional Regulation by FOXP1, FOXP2, and FOXP4 Dimerization
Authors: The ORFeome Collaboration
HsCD00297105

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2031nts         Open reading frame : 35 to 2065
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGATGCAAGAATCTGGGACTGAGAC
AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
CAGTGGTAACCCTTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCT
CAATGCAGCTTTACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTC
CATGGGAAATCCCACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGC
AATGGAGCATACCAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGC
CGTGCATCCTGTACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCT
GTCCTTAGTGACAACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGA
TGAACCAGTAAACGAGGACATGGAGTCAGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 527
End on reference sequence 2560
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FOXP1
Symbol Nomenclature : FOXP1
SYNONYM : 12CC4; QRF1; hFKH1B
Designation : fork head-related protein like B|forkhead box protein P1|glutamine-rich factor 1
Full Nomenclature : forkhead box P1
GENEID : 27086
Locus Tag : HSPC215
GI : 157169605
GenBank Accession : BC152752
HGNC : 3823
MIM : 605515
Vega : OTTHUMG00000158803
Target GenBank: NM_032682.4

 

Reference Sequence Alignment

  

HsCD00297105        GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGATGCAAGAATCTGGGACTGAGAC
NM_001244815.1      ----------------------------ATGTTCCAGTGTGTTTTCTCTTCGAGTGTGCT
NM_032682.5         ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
NM_001244814.1      ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
XM_005264729.1      ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
NM_001244808.1      ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
NM_001244816.1      ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
NM_001244810.1      ----------------------------------ATGATGCAAGAATCTGGGACTGAGAC
                                                      .:*:   :: :.***  ** **:*. 

HsCD00297105        AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
NM_001244815.1      TCAGCCGCACAGTACTTCCTGTTTATTCAAACATCTTTTTTACCACTCGGCAACCCCCGC
NM_032682.5         AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
NM_001244814.1      AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
XM_005264729.1      AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
NM_001244808.1      AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
NM_001244816.1      AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
NM_001244810.1      AAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTG
                    :.*..  .**.**:*: **:   :.:: ... .       :.*.** .   *. . .   

HsCD00297105        CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
NM_001244815.1      TTCGCAGAAACAGCCAGAACCCATCTACAGCAAGAAGACGGAAATCCAAAGGCAGACAGT
NM_032682.5         CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
NM_001244814.1      CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
XM_005264729.1      CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
NM_001244808.1      CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
NM_001244816.1      CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
NM_001244810.1      CGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGC
                         . .::*.* ..*..*  : *:**.*..***.*.***...*  *.*   .*.*** 

HsCD00297105        TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
NM_001244815.1      ACGGGCTCCCTTCGCCAAACTCTTCATTTTCTCTGCACTTCAGGTGGCAAGACAGCTCCT
NM_032682.5         TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
NM_001244814.1      TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
XM_005264729.1      TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
NM_001244808.1      TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
NM_001244816.1      TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
NM_001244810.1      TGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGGCACTTCAGGTGGCAAGACAGCTCCT
                    : .     ** :****.*.*:  : .:  :. . **************************

HsCD00297105        TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_001244815.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_032682.5         TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_001244814.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
XM_005264729.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_001244808.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_001244816.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
NM_001244810.1      TCTTCAGCAGCAACAGCAGCAGCAAGTTAGTGGATTAAAATCTCCCAAGAGGAATGACAA
                    ************************************************************

HsCD00297105        ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_001244815.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_032682.5         ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_001244814.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
XM_005264729.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_001244808.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_001244816.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
NM_001244810.1      ACAACCAGCTCTTCAGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTATCACTCC
                    ************************************************************

HsCD00297105        CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_001244815.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_032682.5         CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_001244814.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
XM_005264729.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_001244808.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_001244816.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
NM_001244810.1      CCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCTCAGCAGCTCCAGGTTCT
                    ************************************************************

HsCD00297105        CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_001244815.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_032682.5         CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_001244814.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
XM_005264729.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_001244808.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_001244816.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
NM_001244810.1      CCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTTTATAAAAA
                    ************************************************************

HsCD00297105        ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_001244815.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_032682.5         ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_001244814.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
XM_005264729.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_001244808.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_001244816.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
NM_001244810.1      ACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAACAGCCTAA
                    ************************************************************

HsCD00297105        AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_001244815.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_032682.5         AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_001244814.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
XM_005264729.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_001244808.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_001244816.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
NM_001244810.1      AGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTACAGATGCA
                    ************************************************************

HsCD00297105        GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_001244815.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_032682.5         GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_001244814.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
XM_005264729.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_001244808.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_001244816.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
NM_001244810.1      GCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCAAGGCCTTCTGACAATTCAGCC
                    ************************************************************

HsCD00297105        CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_001244815.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_032682.5         CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_001244814.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
XM_005264729.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_001244808.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_001244816.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
NM_001244810.1      CGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAGAACTGCA
                    ************************************************************

HsCD00297105        GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_001244815.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_032682.5         GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_001244814.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
XM_005264729.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_001244808.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_001244816.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
NM_001244810.1      GCAGCTCTGGAAAGAAGTGACAAGTGCTCATACTGCAGAAGAAACCACAGGCAACAATCA
                    ************************************************************

HsCD00297105        CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_001244815.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_032682.5         CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_001244814.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
XM_005264729.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_001244808.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_001244816.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
NM_001244810.1      CAGCAGTTTGGATCTGACCACGACATGTGTCTCCTCCTCTGCACCTTCCAAGACCTCCTT
                    ************************************************************

HsCD00297105        AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_001244815.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_032682.5         AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_001244814.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
XM_005264729.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_001244808.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_001244816.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
NM_001244810.1      AATAATGAACCCACATGCCTCTACCAATGGACAGCTCTCAGTCCACACTCCCAAAAGGGA
                    ************************************************************

HsCD00297105        AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_001244815.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_032682.5         AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_001244814.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
XM_005264729.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_001244808.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_001244816.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
NM_001244810.1      AAGTTTGTCCCATGAGGAGCACCCCCATAGCCATCCTCTCTATGGACATGGTGTATGCAA
                    ************************************************************

HsCD00297105        GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_001244815.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_032682.5         GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_001244814.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
XM_005264729.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_001244808.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_001244816.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
NM_001244810.1      GTGGCCAGGCTGTGAAGCAGTGTGCGAAGATTTCCAATCATTTCTAAAACATCTCAACAG
                    ************************************************************

HsCD00297105        TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_001244815.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_032682.5         TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_001244814.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
XM_005264729.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_001244808.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_001244816.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
NM_001244810.1      TGAGCATGCGCTGGACGATAGAAGTACAGCCCAATGTAGAGTACAAATGCAGGTTGTACA
                    ************************************************************

HsCD00297105        GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_001244815.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_032682.5         GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_001244814.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
XM_005264729.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_001244808.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_001244816.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
NM_001244810.1      GCAGTTAGAGCTACAGCTTGCAAAAGACAAAGAACGCCTGCAAGCCATGATGACCCACCT
                    ************************************************************

HsCD00297105        GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_001244815.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_032682.5         GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_001244814.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
XM_005264729.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_001244808.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_001244816.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
NM_001244810.1      GCATGTGAAGTCTACAGAACCCAAAGCCGCCCCTCAGCCCTTGAATCTGGTATCAAGTGT
                    ************************************************************

HsCD00297105        CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_001244815.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_032682.5         CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_001244814.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
XM_005264729.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_001244808.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_001244816.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
NM_001244810.1      CACTCTCTCCAAGTCCGCATCGGAGGCTTCTCCACAGAGCTTACCTCATACTCCAACGAC
                    ************************************************************

HsCD00297105        CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_001244815.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_032682.5         CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_001244814.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
XM_005264729.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_001244808.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_001244816.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
NM_001244810.1      CCCAACCGCCCCCCTGACTCCCGTCACCCAAGGCCCCTCTGTCATCACAACCACCAGCAT
                    ************************************************************

HsCD00297105        GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
NM_001244815.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
NM_032682.5         GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
NM_001244814.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
XM_005264729.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
NM_001244808.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCG--
NM_001244816.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
NM_001244810.1      GCACACGGTGGGACCCATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCGTC
                    **********************************************************  

HsCD00297105        AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_001244815.1      AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_032682.5         AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_001244814.1      AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
XM_005264729.1      AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_001244808.1      -TCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_001244816.1      AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
NM_001244810.1      AGCAGATATTGCGCAGAACCAAGAATTTTATAAGAACGCAGAAGTTAGACCACCATTTAC
                      **********************************************************

HsCD00297105        ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_001244815.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_032682.5         ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_001244814.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
XM_005264729.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_001244808.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_001244816.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
NM_001244810.1      ATATGCATCTTTAATTAGGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAA
                    ************************************************************

HsCD00297105        TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_001244815.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_032682.5         TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_001244814.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
XM_005264729.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_001244808.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_001244816.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
NM_001244810.1      TGAGATCTATAACTGGTTCACACGAATGTTTGCTTACTTCCGACGCAACGCGGCCACGTG
                    ************************************************************

HsCD00297105        GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
NM_001244815.1      GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
NM_032682.5         GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
NM_001244814.1      GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
XM_005264729.1      GAAGGGTGCCATTCGCACCAACCTCTCACTGCATAAGTGCTTTATCAGAGTAGAGGATGA
NM_001244808.1      GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
NM_001244816.1      GAAGAATGCAGTGCGTCATAATCTTAGTCTTCACAAGTGTTTTGTGCGAGTAGAAAACGT
NM_001244810.1      GAAGGGTGCCATTCGCACCAACCTCTCACTGCATAAGTGCTTTATCAGAGTAGAGGATGA
                    ****..***..* ** .. ** ** : :** ** ***** ***.* .*******..* *:

HsCD00297105        TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
NM_001244815.1      TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
NM_032682.5         TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
NM_001244814.1      TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
XM_005264729.1      GTTTGGGTCCTTTTGGACAGTTGATGATGAAGAGTTTAAACGTGGCCGCCATATTCAACG
NM_001244808.1      TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
NM_001244816.1      TAAAGGGGCAGTATGGACAGTGGATGAAGTAGAATTCCAAAAACGAAGGCCACAAAAGAT
NM_001244810.1      GTTTGGGTCCTTTTGGACAGTTGATGATGAAGAGTTTAAACGTGGCCGCCATATTCAACG
                     :::*** *. *:******** *****:*:***.** .**..: *..* *.:.::.*.. 

HsCD00297105        CAGTGG------------------------------------------------TAACCC
NM_001244815.1      CAGTGG------------------------------------------------TAACCC
NM_032682.5         CAGTGG------------------------------------------------TAACCC
NM_001244814.1      CAGTG------------------------------------------------GTAACCC
XM_005264729.1      AGGCCGTCCTCGCAAATACTGCCCCGATGAAAACTTTGACGAGCTTGTCGCACATAACCC
NM_001244808.1      CAGTGG------------------------------------------------TAACCC
NM_001244816.1      CAGTGG------------------------------------------------TAACCC
NM_001244810.1      AGGCCGTCCTCGCAAATACTGCCCCGATGAAAACTTTGACGAGCTTGTCGCACATAACCC
                    ..*                                                   ******

HsCD00297105        TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_001244815.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_032682.5         TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_001244814.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
XM_005264729.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_001244808.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_001244816.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
NM_001244810.1      TTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACCTCTCAATGCAGCTTT
                    ************************************************************

HsCD00297105        ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_001244815.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_032682.5         ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_001244814.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
XM_005264729.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_001244808.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_001244816.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
NM_001244810.1      ACAGGCTTCAATGGCTGAGAATAGTATACCTCTATACACTACCGCTTCCATGGGAAATCC
                    ************************************************************

HsCD00297105        CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_001244815.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_032682.5         CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_001244814.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
XM_005264729.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_001244808.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_001244816.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
NM_001244810.1      CACTCTGGGCAACTTAGCCAGCGCAATACGGGAAGAGCTGAACGGGGCAATGGAGCATAC
                    ************************************************************

HsCD00297105        CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_001244815.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_032682.5         CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_001244814.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
XM_005264729.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_001244808.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_001244816.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
NM_001244810.1      CAACAGCAACGAGAGTGACAGCAGTCCAGGCAGATCTCCTATGCAAGCCGTGCATCCTGT
                    ************************************************************

HsCD00297105        ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_001244815.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_032682.5         ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_001244814.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
XM_005264729.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_001244808.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_001244816.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
NM_001244810.1      ACACGTCAAAGAAGAGCCCCTCGATCCAGAGGAAGCTGAAGGGCCCCTGTCCTTAGTGAC
                    ************************************************************

HsCD00297105        AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_001244815.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_032682.5         AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_001244814.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
XM_005264729.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_001244808.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_001244816.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
NM_001244810.1      AACAGCCAACCACAGTCCAGATTTTGACCATGACAGAGATTACGAAGATGAACCAGTAAA
                    ************************************************************

HsCD00297105        CGAGGACATGGAGTCAGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_001244815.1      CGAGGACATGGAGTGA---------------------------
NM_032682.5         CGAGGACATGGAGTGA---------------------------
NM_001244814.1      CGAGGACATGGAGTGA---------------------------
XM_005264729.1      CGAGGACATGGAGTGA---------------------------
NM_001244808.1      CGAGGACATGGAGTGA---------------------------
NM_001244816.1      CGAGGACATGGAGTGA---------------------------
NM_001244810.1      CGAGGACATGGAGTGA---------------------------
                    ************** *                           

Protein

SMART domain : FH : FORKHEAD
UniProt : Q9BSG9
UniProt : Q9H334
UniProt : Q548T7
HPRD : 18518

Clone

Cloning Information : 269777
HIP Master Clone ID : 201279
IMAGE ID : 100015965
Original Clone ID : FLH269777.01L

Organism


TAX_ID : 9606
Species Specific ID: 27086

Genome

Chromosome : 3
Map Location : 3p14.1
Ensembl : ENSG00000114861

Reagents

Labome : FOXP1-antibody