DNASU Plasmid Repository • 480.965.5697 | Email

GNAS (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GNAS
Gene Name:  GNAS complex locus
Sequence             
Original Clone ID: FLH269888.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00297120

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3111nts         Open reading frame : 1 to 3111
Reference Sequence Alignment

ATGGGCGTGCGCAACTGCCTCTACGGCAATAATATGTCAGGACAACGCGATATCCCCCCT
GAAATCGGGGAACAGCCCGAGCAACCACCTTTGGAGGCCCCAGGGGCAGCTGCCCCCGGT
GCTGGGCCTAGCCCAGCCGAAGAGATGGAGACCGAACCGCCTCACAACGAGCCCATCCCC
GTCGAGAATGATGGCGAGGCCTGTGGACCCCCAGAGGTCTCCAGACCCAACTTTCAGGTC
CTCAACCCGGCATTCAGGGAAGCTGGAGCCCATGGAAGCTACAGCCCACCTCCTGAGGAA
GCAATGCCCTTCGAGGCTGAACAGCCCAGCTTGGGAGGCTTCTGGCCTACACTGGAGCAG
CCTGGATTCCCCAGTGGGGTCCATGCAGGCCTTGAGGCCTTCGGCCCAGCACTCATGGAG
CCCGGAGCCTTCAGTGGTGCCAGACCAGGCCTGGGAGGATACAGCCCTCCACCAGAAGAA
GCTATGCCCTTTGAGTTTGACCAGCCTGCCCAGAGAGGCTGCAGTCAACTTCTCTTACAG
GTCCCAGACCTTGCTCCAGGAGGCCCAGGTGCTGCAGGGGTCCCCGGAGCTCCTCCCGAG
GAGCCCCAAGCCCTCAGGCCTGCAAAGGCTGGCTCCAGAGGAGGCTACAGCCCTCCCCCT
GAGGAGACTATGCCATTTGAGCTTGATGGAGAAGGATTTGGGGACGACAGCCCACCCCCG
GGGCTTTCCCGAGTTATCGCACAAGTCGACGGCAGCAGCCAGTTCGCGGCAGTCGCGGCC
TCGAGTGCGGTCCGCCTCACTCCCGCCGCGAACGCGCCTCCCCTCTGGGTCCCAGGCGCC
ATCGGCAGCCCATCCCAAGAGGCTGTCAGACCTCCTTCTAACTTCACGGGCAGCAGCCCC
TGGATGGAGATCTCCGGACCCCCGTTCGAGATTGGCAGCGCCCCCGCTGGGGTCGACGAC
ACTCCCGTCAACATGGACAGCCCCCCAATCGCGCTTGACGGCCCGCCCATCAAGGTCTCC
GGAGCCCCAGATAAGAGAGAGCGAGCAGAGAGACCCCCAGTTGAGGAGGAAGCAGCAGAG
ATGGAAGGAGCCGCTGATGCCGCGGAGGGAGGAAAAGTACCCTCTCCGGGGTACGGATCC
CCTGCCGCCGGGGCAGCCTCAGCGGATACCGCTGCCAGGGCAGCCCCTGCAGCCCCAGCC
GATCCTGACTCCGGGGCAACCCCAGAAGATCCCGACTCCGGGACAGCACCAGCCGATCCT
GACTCCGGGGCATTCGCAGCCGATCCCGACTCCGGGGCAGCCCCTGCCGCCCCAGCCGAT
CCCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCCTGAC
GCCCCAGCCGATCCAGATGCCGGGGCGGCCCCTGAGGCTCCCGCCGCCCCTGCGGCTGCT
GAGACCCGGGCAGCCCATGTCGCCCCAGCTGCGCCAGACGCAGGGGCTCCCACTGCCCCA
GCCGCTTCTGCCACCCGGGCAGCCCAAGTCCGCCGGGCGGCCTCTGCAGCCCCTGCCTCC
GGGGCCAGACGCAAGATCCATCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCCGATCCG
CCTACTCCGCGGCCTACTCGCGCGTCTGCCTGGCGGGGCAAGTCCGAGAGCAGCCGCGGC
CGCCGCGTGTACTACGATGAAGGGGTGGCCAGCAGCGACGATGACTCCAGCGGAGACGAG
TCCGACGATGGGACCTCCGGATGCCTCCGCTGGTTTCAGCATCGGCGAAATCGCCGCCGC
CGAAAGCCCCAGCGCAACTTACTCCGCAACTTTCTCGTGCAAGCCTTCGGGGGCTGCTTC
GGTCGATCTGAGAGTCCCCAGCCCAAAGCCTCGCGCTCTCTCAAGGTCAAGAAGGTACCC
CTGGCGGAGAAGCGCAGACAGATGCGCAAAGAAGCCCTGGAGAAGCGGGCCCAGAAGCGC
GCAGAGAAGAAACGCAGTAAGCTCATCGACAAACAACTCCAGGACGAAAAGATGGGCTAC
ATGTGTACGCACCGCCTGCTGCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
CAGGCTGCAAGGAGCAACAGCGATGGTGAGAAGGCAACCAAAGTGCAGGACATCAAAAAC
AACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTG
GAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAACGTG
CCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAA
GGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAGTAC
TTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGACCTG
CTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTC
AACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAGTGC
TTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATC
CGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGG
AACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTGCTC
GCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGC
TACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGGGCC
AAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGTCAC
TACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTCAAC
GACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 286
End on reference sequence 3399
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GNAS
Symbol Nomenclature : GNAS
SYNONYM : AHO; C20orf45; GNAS1; GPSA; GSA; GSP; NESP; PHP1A; PHP1B; PHP1C; POH
Designation : adenylate cyclase-stimulating G alpha protein|alternative gene product encoded by XL-exon|extra large alphas protein|guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1|guanine nucleotide regulatory protein|guanine nucleotide-binding protein G(s) subunit alpha isoforms XLas|neuroendocrine secretory protein|protein ALEX|secretogranin VI
Full Nomenclature : GNAS complex locus
GENEID : 2778
Locus Tag : RP4-543J19.4
HGNC : 4392
MIM : 139320
Vega : OTTHUMG00000033069
Target GenBank: NM_080425.2

 

Reference Sequence Alignment

  

HsCD00297120      ATGGGCGTGCGCAACTGCCTCTACGGCAATAATATGTCAGGACAACGCGATATCCCCCCT
NM_080425.2       ATGGGCGTGCGCAACTGCCTCTACGGCAATAATATGTCAGGACAACGCGATATCCCCCCT
                  ************************************************************

HsCD00297120      GAAATCGGGGAACAGCCCGAGCAACCACCTTTGGAGGCCCCAGGGGCAGCTGCCCCCGGT
NM_080425.2       GAAATCGGGGAACAGCCCGAGCAACCACCTTTGGAGGCCCCAGGGGCAGCTGCCCCCGGT
                  ************************************************************

HsCD00297120      GCTGGGCCTAGCCCAGCCGAAGAGATGGAGACCGAACCGCCTCACAACGAGCCCATCCCC
NM_080425.2       GCTGGGCCTAGCCCAGCCGAAGAGATGGAGACCGAACCGCCTCACAACGAGCCCATCCCC
                  ************************************************************

HsCD00297120      GTCGAGAATGATGGCGAGGCCTGTGGACCCCCAGAGGTCTCCAGACCCAACTTTCAGGTC
NM_080425.2       GTCGAGAATGATGGCGAGGCCTGTGGACCCCCAGAGGTCTCCAGACCCAACTTTCAGGTC
                  ************************************************************

HsCD00297120      CTCAACCCGGCATTCAGGGAAGCTGGAGCCCATGGAAGCTACAGCCCACCTCCTGAGGAA
NM_080425.2       CTCAACCCGGCATTCAGGGAAGCTGGAGCCCATGGAAGCTACAGCCCACCTCCTGAGGAA
                  ************************************************************

HsCD00297120      GCAATGCCCTTCGAGGCTGAACAGCCCAGCTTGGGAGGCTTCTGGCCTACACTGGAGCAG
NM_080425.2       GCAATGCCCTTCGAGGCTGAACAGCCCAGCTTGGGAGGCTTCTGGCCTACACTGGAGCAG
                  ************************************************************

HsCD00297120      CCTGGATTCCCCAGTGGGGTCCATGCAGGCCTTGAGGCCTTCGGCCCAGCACTCATGGAG
NM_080425.2       CCTGGATTCCCCAGTGGGGTCCATGCAGGCCTTGAGGCCTTCGGCCCAGCACTCATGGAG
                  ************************************************************

HsCD00297120      CCCGGAGCCTTCAGTGGTGCCAGACCAGGCCTGGGAGGATACAGCCCTCCACCAGAAGAA
NM_080425.2       CCCGGAGCCTTCAGTGGTGCCAGACCAGGCCTGGGAGGATACAGCCCTCCACCAGAAGAA
                  ************************************************************

HsCD00297120      GCTATGCCCTTTGAGTTTGACCAGCCTGCCCAGAGAGGCTGCAGTCAACTTCTCTTACAG
NM_080425.2       GCTATGCCCTTTGAGTTTGACCAGCCTGCCCAGAGAGGCTGCAGTCAACTTCTCTTACAG
                  ************************************************************

HsCD00297120      GTCCCAGACCTTGCTCCAGGAGGCCCAGGTGCTGCAGGGGTCCCCGGAGCTCCTCCCGAG
NM_080425.2       GTCCCAGACCTTGCTCCAGGAGGCCCAGGTGCTGCAGGGGTCCCCGGAGCTCCTCCCGAG
                  ************************************************************

HsCD00297120      GAGCCCCAAGCCCTCAGGCCTGCAAAGGCTGGCTCCAGAGGAGGCTACAGCCCTCCCCCT
NM_080425.2       GAGCCCCAAGCCCTCAGGCCTGCAAAGGCTGGCTCCAGAGGAGGCTACAGCCCTCCCCCT
                  ************************************************************

HsCD00297120      GAGGAGACTATGCCATTTGAGCTTGATGGAGAAGGATTTGGGGACGACAGCCCACCCCCG
NM_080425.2       GAGGAGACTATGCCATTTGAGCTTGATGGAGAAGGATTTGGGGACGACAGCCCACCCCCG
                  ************************************************************

HsCD00297120      GGGCTTTCCCGAGTTATCGCACAAGTCGACGGCAGCAGCCAGTTCGCGGCAGTCGCGGCC
NM_080425.2       GGGCTTTCCCGAGTTATCGCACAAGTCGACGGCAGCAGCCAGTTCGCGGCAGTCGCGGCC
                  ************************************************************

HsCD00297120      TCGAGTGCGGTCCGCCTCACTCCCGCCGCGAACGCGCCTCCCCTCTGGGTCCCAGGCGCC
NM_080425.2       TCGAGTGCGGTCCGCCTCACTCCCGCCGCGAACGCGCCTCCCCTCTGGGTCCCAGGCGCC
                  ************************************************************

HsCD00297120      ATCGGCAGCCCATCCCAAGAGGCTGTCAGACCTCCTTCTAACTTCACGGGCAGCAGCCCC
NM_080425.2       ATCGGCAGCCCATCCCAAGAGGCTGTCAGACCTCCTTCTAACTTCACGGGCAGCAGCCCC
                  ************************************************************

HsCD00297120      TGGATGGAGATCTCCGGACCCCCGTTCGAGATTGGCAGCGCCCCCGCTGGGGTCGACGAC
NM_080425.2       TGGATGGAGATCTCCGGACCCCCGTTCGAGATTGGCAGCGCCCCCGCTGGGGTCGACGAC
                  ************************************************************

HsCD00297120      ACTCCCGTCAACATGGACAGCCCCCCAATCGCGCTTGACGGCCCGCCCATCAAGGTCTCC
NM_080425.2       ACTCCCGTCAACATGGACAGCCCCCCAATCGCGCTTGACGGCCCGCCCATCAAGGTCTCC
                  ************************************************************

HsCD00297120      GGAGCCCCAGATAAGAGAGAGCGAGCAGAGAGACCCCCAGTTGAGGAGGAAGCAGCAGAG
NM_080425.2       GGAGCCCCAGATAAGAGAGAGCGAGCAGAGAGACCCCCAGTTGAGGAGGAAGCAGCAGAG
                  ************************************************************

HsCD00297120      ATGGAAGGAGCCGCTGATGCCGCGGAGGGAGGAAAAGTACCCTCTCCGGGGTACGGATCC
NM_080425.2       ATGGAAGGAGCCGCTGATGCCGCGGAGGGAGGAAAAGTACCCTCTCCGGGGTACGGATCC
                  ************************************************************

HsCD00297120      CCTGCCGCCGGGGCAGCCTCAGCGGATACCGCTGCCAGGGCAGCCCCTGCAGCCCCAGCC
NM_080425.2       CCTGCCGCCGGGGCAGCCTCAGCGGATACCGCTGCCAGGGCAGCCCCTGCAGCCCCAGCC
                  ************************************************************

HsCD00297120      GATCCTGACTCCGGGGCAACCCCAGAAGATCCCGACTCCGGGACAGCACCAGCCGATCCT
NM_080425.2       GATCCTGACTCCGGGGCAACCCCAGAAGATCCCGACTCCGGGACAGCACCAGCCGATCCT
                  ************************************************************

HsCD00297120      GACTCCGGGGCATTCGCAGCCGATCCCGACTCCGGGGCAGCCCCTGCCGCCCCAGCCGAT
NM_080425.2       GACTCCGGGGCATTCGCAGCCGATCCCGACTCCGGGGCAGCCCCTGCCGCCCCAGCCGAT
                  ************************************************************

HsCD00297120      CCCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCCTGAC
NM_080425.2       CCCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCCTGAC
                  ************************************************************

HsCD00297120      GCCCCAGCCGATCCAGATGCCGGGGCGGCCCCTGAGGCTCCCGCCGCCCCTGCGGCTGCT
NM_080425.2       GCCCCAGCCGATCCAGATGCCGGGGCGGCCCCTGAGGCTCCCGCCGCCCCTGCGGCTGCT
                  ************************************************************

HsCD00297120      GAGACCCGGGCAGCCCATGTCGCCCCAGCTGCGCCAGACGCAGGGGCTCCCACTGCCCCA
NM_080425.2       GAGACCCGGGCAGCCCATGTCGCCCCAGCTGCGCCAGACGCAGGGGCTCCCACTGCCCCA
                  ************************************************************

HsCD00297120      GCCGCTTCTGCCACCCGGGCAGCCCAAGTCCGCCGGGCGGCCTCTGCAGCCCCTGCCTCC
NM_080425.2       GCCGCTTCTGCCACCCGGGCAGCCCAAGTCCGCCGGGCGGCCTCTGCAGCCCCTGCCTCC
                  ************************************************************

HsCD00297120      GGGGCCAGACGCAAGATCCATCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCCGATCCG
NM_080425.2       GGGGCCAGACGCAAGATCCATCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCCGATCCG
                  ************************************************************

HsCD00297120      CCTACTCCGCGGCCTACTCGCGCGTCTGCCTGGCGGGGCAAGTCCGAGAGCAGCCGCGGC
NM_080425.2       CCTACTCCGCGGCCTACTCGCGCGTCTGCCTGGCGGGGCAAGTCCGAGAGCAGCCGCGGC
                  ************************************************************

HsCD00297120      CGCCGCGTGTACTACGATGAAGGGGTGGCCAGCAGCGACGATGACTCCAGCGGAGACGAG
NM_080425.2       CGCCGCGTGTACTACGATGAAGGGGTGGCCAGCAGCGACGATGACTCCAGCGGAGACGAG
                  ************************************************************

HsCD00297120      TCCGACGATGGGACCTCCGGATGCCTCCGCTGGTTTCAGCATCGGCGAAATCGCCGCCGC
NM_080425.2       TCCGACGATGGGACCTCCGGATGCCTCCGCTGGTTTCAGCATCGGCGAAATCGCCGCCGC
                  ************************************************************

HsCD00297120      CGAAAGCCCCAGCGCAACTTACTCCGCAACTTTCTCGTGCAAGCCTTCGGGGGCTGCTTC
NM_080425.2       CGAAAGCCCCAGCGCAACTTACTCCGCAACTTTCTCGTGCAAGCCTTCGGGGGCTGCTTC
                  ************************************************************

HsCD00297120      GGTCGATCTGAGAGTCCCCAGCCCAAAGCCTCGCGCTCTCTCAAGGTCAAGAAGGTACCC
NM_080425.2       GGTCGATCTGAGAGTCCCCAGCCCAAAGCCTCGCGCTCTCTCAAGGTCAAGAAGGTACCC
                  ************************************************************

HsCD00297120      CTGGCGGAGAAGCGCAGACAGATGCGCAAAGAAGCCCTGGAGAAGCGGGCCCAGAAGCGC
NM_080425.2       CTGGCGGAGAAGCGCAGACAGATGCGCAAAGAAGCCCTGGAGAAGCGGGCCCAGAAGCGC
                  ************************************************************

HsCD00297120      GCAGAGAAGAAACGCAGTAAGCTCATCGACAAACAACTCCAGGACGAAAAGATGGGCTAC
NM_080425.2       GCAGAGAAGAAACGCAGTAAGCTCATCGACAAACAACTCCAGGACGAAAAGATGGGCTAC
                  ************************************************************

HsCD00297120      ATGTGTACGCACCGCCTGCTGCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
NM_080425.2       ATGTGTACGCACCGCCTGCTGCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTG
                  ************************************************************

HsCD00297120      AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
NM_080425.2       AAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCG
                  ************************************************************

HsCD00297120      CAGGCTGCAAGGAGCAACAGCGATGGTGAGAAGGCAACCAAAGTGCAGGACATCAAAAAC
NM_080425.2       CAGGCTGCAAGGAGCAACAGCGATGGTGAGAAGGCAACCAAAGTGCAGGACATCAAAAAC
                  ************************************************************

HsCD00297120      AACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTG
NM_080425.2       AACCTGAAAGAGGCGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTG
                  ************************************************************

HsCD00297120      GAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAACGTG
NM_080425.2       GAGCTGGCCAACCCCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAACGTG
                  ************************************************************

HsCD00297120      CCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAA
NM_080425.2       CCTGACTTTGACTTCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAA
                  ************************************************************

HsCD00297120      GGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAGTAC
NM_080425.2       GGAGTGCGTGCCTGCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAGTAC
                  ************************************************************

HsCD00297120      TTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGACCTG
NM_080425.2       TTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGACCTG
                  ************************************************************

HsCD00297120      CTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTC
NM_080425.2       CTTCGCTGCCGTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTC
                  ************************************************************

HsCD00297120      AACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAGTGC
NM_080425.2       AACTTCCACATGTTTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAGTGC
                  ************************************************************

HsCD00297120      TTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATC
NM_080425.2       TTCAACGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATC
                  ************************************************************

HsCD00297120      CGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGG
NM_080425.2       CGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGG
                  ************************************************************

HsCD00297120      AACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTGCTC
NM_080425.2       AACAACAGATGGCTGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTGCTC
                  ************************************************************

HsCD00297120      GCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGC
NM_080425.2       GCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGC
                  ************************************************************

HsCD00297120      TACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGGGCC
NM_080425.2       TACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGGGCC
                  ************************************************************

HsCD00297120      AAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGTCAC
NM_080425.2       AAGTACTTCATTCGAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGTCAC
                  ************************************************************

HsCD00297120      TACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTCAAC
NM_080425.2       TACTGCTACCCTCATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTCAAC
                  ************************************************************

HsCD00297120      GACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTC---
NM_080425.2       GACTGCCGTGACATCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA
                  ***************************************************   

Pathways

Panther : Endothelin signaling pathway
Reactome : Aquaporin-mediated transport
Reactome : Class B/2 (Secretin family receptors)
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G alpha (z) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Glucagon-type ligand receptors
Reactome : Hemostasis
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : PKA activation in glucagon signalling
Reactome : Platelet homeostasis
Reactome : Prostacyclin signalling through prostacyclin receptor
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Transmembrane transport of small molecules
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Estrogen signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : TSH signaling pathway

Protein

SMART domain : G_alpha : G protein alpha subunit
UniProt : P63092
UniProt : O95467
UniProt : A6NI00
UniProt : P84996
UniProt : Q5JWF2
HPRD : 00761

Clone

Cloning Information : 269888
HIP Master Clone ID : 201390
IMAGE ID : 100058938
Original Clone ID : FLH269888.01L

Organism


TAX_ID : 9606
Species Specific ID: 2778

Genome

Chromosome : 20
Map Location : 20q13.3
Ensembl : ENSG00000087460

Reagents

Labome : GNAS-antibody