DNASU Plasmid Repository • 480.965.5697 | Email

PTPRN2 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPRN2
Gene Name:  protein tyrosine phosphatase, receptor type, N polypeptide 2
Sequence             
Original Clone ID: 8621a8BCt8p1
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: C-terminal 6-His, TOPO
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00297758

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 930nts         Open reading frame : 48 to 977
Reference Sequence Alignment

TCTGAATATTTTGTTTAACTTTAGAAGGAGATATACATATGTCCCTTTCCGAGGAGCCTG
TGCAGTCCAACATGGACATCTCCACCGGCCACATGATCCTGTCCTACATGGAGGACCACC
TGAAGAACAAGAACCGGCTGGAGAAGGAGTGGGAAGCGCTGTGCGCCTACCAGGCGGAGC
CCAACAGCTCGTTCGTGGCCCAGAGGGAGGAGAACGTGCCCAAGAACCGCTCCCTGGCTG
TGCTGACCTATGACCACTCCCGGGTCCTGCTGAAGGCGGAGAACAGCCACAGCCACTCAG
ACTACATCAACGCTAGCCCTATCATGGATCACGACCCGAGGAACCCGGCGTACATCGCCA
CCCAGGGACCGCTGCCCGCCACCGTGGCTGACTTTTGGCAGATGGTGTGGGAGAGCGGCT
GCGTGGTGATCGTCATGCTGACACCCCTCGCGGAGAACGGCGTCCGGCAGTGCTACCACT
ACTGGCCGGATGAAGGCTCCAATCTCTACCACATCTATGAGGTGAACCTGGTCTCCGAGC
ACATCTGGTGTGAGGACTTCCTGGTGAGGAGCTTCTATCTGAAGAACCTGCAGACCAACG
AGACGCGCACCGTGACGCAGTTCCACTTCCTGAGTTGGTATGACCGAGGAGTCCCTTCCT
CCTCAAGGTCCCTCCTGGACTTCCGCAGAAAAGTAAACAAGTGCTACAGGGGCCGTTCTT
GTCCAATAATTGTTCATTGCAGTGACGGTGCAGGCCGGAGCGGCACCTACGTCCTGATCG
ACATGGTTCTCAACAAGATGGCCAAAGGTGCTAAAGAGATTGATATCGCAGCGACCCTGG
AGCACTTGAGGGACCAGAGACCCGGCATGGTCCAGACGAAGGAGCAGTTTGAGTTCGCGC
TGACAGCCGTGGCTGAGGAGGTGAACGCCATCCTCAAGGCCCTTCCCCAGGAAGGGCATC
ATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAG
CACCAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 930
Start on reference sequence 1
Mutations:
None
Discrepancy:
"c273t,P91P;c300g,P100P;"
                                

5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8621a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPRN2
Symbol Nomenclature : PTPRN2
SYNONYM : IA-2beta; IAR; ICAAR; PTPRP; R-PTP-N2
Designation : IAR/receptor-like protein-tyrosine phosphatase|islet cell autoantigen-related protein|phogrin|protein tyrosine phosphatase receptor pi|receptor-type tyrosine-protein phosphatase N2|tyrosine phosphatase IA-2 beta
Full Nomenclature : protein tyrosine phosphatase, receptor type, N polypeptide 2
GENEID : 5799
GenBank Accession : NP_002838
HGNC : 9677
MIM : 601698
Vega : OTTHUMG00000152646
Target GenBank: NP_002838

 

Reference Sequence Alignment

  

HsCD00297758      ------------------------------------------------------------
NM_002847.3       ATGGGGCCGCCGCTCCCGCTGCTGCTGCTGCTACTGCTGCTGCTGCCGCCACGCGTCCTG
NM_130842.2       ATGGGGCCGCCGCTCCCGCTGCTGCTGCTGCTACTGCTGCTGCTGCCGCCACGCGTCCTG
NM_130843.2       ATGGGGCCGCCGCTCCCGCTGCTGCTGCTGCTACTGCTGCTGCTGCCGCCACGCGTCCTG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CCTGCCGCCCCTTCGTCCGTCCCCCGCGGCCGGCAGCTCCCGGGGCGTCTGGGCTGCCTG
NM_130842.2       CCTGCCGCCCCTTCGTCCGTCCCCCGCGGCCGGCAGCTCCCGGGGCGTCTGG--------
NM_130843.2       CCTGCCGCCCCTTCGTCCGTCCCCCGCGGCCGGCAGCTCCCGGGGCGTCTGGGCTGCCTG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTCGAGGAGGGCCTCTGCGGAGCGTCCGAGGCCTGTGTGAACGATGGAGTGTTTGGAAGG
NM_130842.2       -------------------------------------------ATGGAGTGTTTGGAAGG
NM_130843.2       CTCGAGGAGGGCCTCTGCGGAGCGTCCGAGGCCTGTGTGAACGATGGAGTGTTTGGAAGG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       TGCCAGAAGGTTCCGGCAATGGACTTTTACCGCTACGAGGTGTCGCCCGTGGCCCTGCAG
NM_130842.2       TGCCAGAAGGTTCCGGCAATGGACTTTTACCGCTACGAGGTGTCGCCCGTGGCCCTGCAG
NM_130843.2       TGCCAGAAGGTTCCGGCAATGGACTTTTACCGCTACGAGGTGTCGCCCGTGGCCCTGCAG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CGCCTGCGCGTGGCGTTGCAGAAGCTTTCCGGCACAGGTTTCACGTGGCAGGATGACTAT
NM_130842.2       CGCCTGCGCGTGGCGTTGCAGAAGCTTTCCGGCACAGGTTTCACGTGGCAGGATGACTAT
NM_130843.2       CGCCTGCGCGTGGCGTTGCAGAAGCTTTCCGGCACAGGTTTCACGTGGCAGGATGACTAT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       ACTCAGTATGTGATGGACCAGGAACTTGCAGACCTCCCGAAAACCTACCTGAGGCGTCCT
NM_130842.2       ACTCAGTATGTGATGGACCAGGAACTTGCAGACCTCCCGAAAACCTACCTGAGGCGTCCT
NM_130843.2       ACTCAGTATGTGATGGACCAGGAACTTGCAGACCTCCCGAAAACCTACCTGAGGCGTCCT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GAAGCATCCAGCCCAGCCAGGCCCTCAAAACACAGCGTTGGCAGCGAGAGGAGGTACAGT
NM_130842.2       GAAGCATCCAGCCCAGCCAGGCCCTCAAAACACAGCGTTGGCAGCGAGAGGAGGTACAGT
NM_130843.2       GAAGCATCCAGCCCAGCCAGGCCCTCAAAACACAGCGTTGGCAGCGAGAGGAGGTACAGT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CGGGAGGGCGGTGCTGCCCTGGCCAACGCCCTCCGACGCCACCTGCCCTTCCTGGAGGCC
NM_130842.2       CGGGAGGGCGGTGCTGCCCTGGCCAACGCCCTCCGACGCCACCTGCCCTTCCTGGAGGCC
NM_130843.2       CGGGAGGGCGGTGCTGCCCTGGCCAACGCCCTCCGACGCCACCTGCCCTTCCTGGAGGCC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTGTCCCAGGCCCCAGCCTCAGACGTGCTCGCCAGGACCCATACGGCGCAGGACAGACCC
NM_130842.2       CTGTCCCAGGCCCCAGCCTCAGACGTGCTCGCCAGGACCCATACGGCGCAGGACAGACCC
NM_130843.2       CTGTCCCAGGCCCCAGCCTCAGACGTGCTCGCCAGGACCCATACGGCGCAGGACAGACCC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CCCGCTGAGGGTGATGACCGCTTCTCCGAGAGCATCCTGACCTATGTGGCCCACACGTCT
NM_130842.2       CCCGCTGAGGGTGATGACCGCTTCTCCGAGAGCATCCTGACCTATGTGGCCCACACGTCT
NM_130843.2       CCCGCTGAGGGTGATGACCGCTTCTCCGAGAGCATCCTGACCTATGTGGCCCACACGTCT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GCGCTGACCTACCCTCCCGGGTCCCGGACCCAGCTCCGCGAGGACCTCCTGCCGCGGACC
NM_130842.2       GCGCTGACCTACCCTCCCGGGTCCCGGACCCAGCTCCGCGAGGACCTCCTGCCGCGGACC
NM_130843.2       GCGCTGACCTACCCTCCCGGGTCCCGGACCCAGCTCCGCGAGGACCTCCTGCCGCGGACC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTCGGCCAGCTCCAGCCAGATGAGCTCAGCCCTAAGGTGGACAGTGGTGTGGACAGACAC
NM_130842.2       CTCGGCCAGCTCCAGCCAGATGAGCTCAGCCCTAAGGTGGACAGTGGTGTGGACAGACAC
NM_130843.2       CTCGGCCAGCTCCAGCCAGATGAGCTCAGCCCTAAGGTGGACAGTGGTGTGGACAGACAC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CATCTGATGGCGGCCCTCAGTGCCTATGCTGCCCAGAGGCCCCCAGCTCCCCCCGGGGAG
NM_130842.2       CATCTGATGGCGGCCCTCAGTGCCTATGCTGCCCAGAGGCCCCCAGCTCCCCCCGGGGAG
NM_130843.2       CATCTGATGGCGGCCCTCAGTGCCTATGCTGCCCAGAGGCCCCCAGCTCCCCCCGGGGAG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GGCAGCCTGGAGCCACAGTACCTTCTGCGTGCACCCTCAAGAATGCCCAGGCCTTTGCTG
NM_130842.2       GGCAGCCTGGAGCCACAGTACCTTCTGCGTGCACCCTCAAGAATGCCCAGGCCTTTGCTG
NM_130843.2       GGCAGCCTGGAGCCACAGTACCTTCTGCGTGCACCCTCAAGAATGCCCAGGCCTTTGCTG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GCACCAGCCGCCCCCCAGAAGTGGCCTTCACCTCTGGGAGATTCCGAAGACCCCTCCAGC
NM_130842.2       GCACCAGCCGCCCCCCAGAAGTGGCCTTCACCTCTGGGAGATTCCGAAGACCCCTCCAGC
NM_130843.2       GCACCAGCCGCCCCCCAGAAGTGGCCTTCACCTCTGGGAGATTCCGAAGACCCCTCCAGC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       ACAGGCGATGGAGCACGGATTCATACCCTCCTGAAGGACCTGCAGAGGCAGCCGGCTGAG
NM_130842.2       ACAGGCGATGGAGCACGGATTCATACCCTCCTGAAGGACCTGCAGAGGCAGCCGGCTGAG
NM_130843.2       ACAGGCGATGGAGCACGGATTCATACCCTCCTGAAGGACCTGCAGAGGCAGCCGGCTGAG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GTGAGGGGCCTGAGTGGCCTGGAGCTGGACGGCATGGCTGAGCTGATGGCTGGCCTGATG
NM_130842.2       GTGAGGGGCCTGAGTGGCCTGGAGCTGGACGGCATGGCTGAGCTGATGGCTGGCCTGATG
NM_130843.2       GTGAGGGGCCTGAGTGGCCTGGAGCTGGACGGCATGGCTGAGCTGATGGCTGGCCTGATG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CAAGGCGTGGACCATGGAGTAGCTCGAGGCAGCCCTGGGAGAGCGGCCCTGGGAGAGTCT
NM_130842.2       CAAGGCGTGGACCATGGAGTAGCTCGAGGCAGCCCTGGGAGAGCGGCCCTGGGAGAGTCT
NM_130843.2       CAAGGCGTGGACCATGGAGTAGCTCGAGGCAGCCCTGGGAGAGCGGCCCTGGGAGAGTCT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GGAGAACAGGCGGATGGCCCCAAGGCCACCCTCCGTGGAGACAGCTTTCCAGATGACGGA
NM_130842.2       GGAGAACAGGCGGATGGCCCCAAGGCCACCCTCCGTGGAGACAGCTTTCCAGATGACGGA
NM_130843.2       GGAGAACAGGCGGATGGCCCCAAGGCCACCCTCCGTGGAGACAGCTTTCCAGATGACGGA
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GTGCAGGACGACGATGATAGACTTTACCAAGAGGTCCATCGTCTGAGTGCCACACTCGGG
NM_130842.2       GTGCAGGACGACGATGATAGACTTTACCAAGAGGTCCATCGTCTGAGTGCCACACTCGGG
NM_130843.2       GTGCAGGACGACGATGATAGACTTTACCAAGAGGTCCATCGTCTGAGTGCCACACTCGGG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GGCCTCCTGCAGGACCACGGGTCTCGACTCTTACCTGGAGCCCTCCCCTTTGCAAGGCCC
NM_130842.2       GGCCTCCTGCAGGACCACGGGTCTCGACTCTTACCTGGAGCCCTCCCCTTTGCAAGGCCC
NM_130843.2       GGCCTCCTGCAGGACCACGGGTCTCGACTCTTACCTGGAGCCCTCCCCTTTGCAAGGCCC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTCGACATGGAGAGGAAGAAGTCCGAGCACCCTGAGTCTTCCCTGTCTTCAGAAGAGGAG
NM_130842.2       CTCGACATGGAGAGGAAGAAGTCCGAGCACCCTGAGTCTTCCCTGTCTTCAGAAGAGGAG
NM_130843.2       CTCGACATGGAGAGGAAGAAGTCCGAGCACCCTGAGTCTTCCCTGTCTTCAGAAGAGGAG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       ACTGCCGGAGTGGAGAACGTCAAGAGCCAGACGTATTCCAAAGATCTGCTGGGGCAGCAG
NM_130842.2       ACTGCCGGAGTGGAGAACGTCAAGAGCCAGACGTATTCCAAAGATCTGCTGGGGCAGCAG
NM_130843.2       ACTGCCGGAGTGGAGAACGTCAAGAGCCAGACGTATTCCAAAGATCTGCTGGGGCAGCAG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CCGCATTCGGAGCCCGGGGCCGCTGCGTTTGGGGAGCTCCAAAACCAGATGCCTGGGCCC
NM_130842.2       CCGCATTCGGAGCCCGGGGCCGCTGCGTTTGGGGAGCTCCAAAACCAGATGCCTGGGCCC
NM_130843.2       CCGCATTCGGAGCCCGGGGCCGCTGCGTTTGGGGAGCTCCAAAACCAGATGCCTGGGCCC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       TCGAAGGAGGAGCAGAGCCTTCCAGCGGGTGCTCAGGAGGCCCTCAGCGACGGCCTGCAA
NM_130842.2       TCGAAGGAGGAGCAGAGCCTTCCAGCGGGTGCTCAGGAGGCCCTCAGCGACGGCCTGCAA
NM_130843.2       TCGAAGGAGGAGCAGAGCCTTCCAGCGGGTGCTCAGGAGGCCCTCAGCGACGGCCTGCAA
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       TTGGAGGTCCAGCCTTCCGAGGAAGAGGCGCGGGGCTACATCGTGACAGACAGAGACCCC
NM_130842.2       TTGGAGGTCCAGCCTTCCGAGGAAGAGGCGCGGGGCTACATCGTGACAGACAGAGACCCC
NM_130843.2       TTGGAGGTCCAGCCTTCCGAGGAAGAGGCGCGGGGCTACATCGTGACAGACAGAGAGGTT
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTGCGCCCCGAGGAAGGAAGGCGGCTGGTGGAGGACGTCGCCCGCCTCCTGCAGGTGCCC
NM_130842.2       CTGCGCCCCGAGGAAGGAAGGCGGCTGGTGGAGGACGTCGCCCGCCTCCTGCAGGTGCCC
NM_130843.2       CTCG--------------------------------------------------------
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       AGCAGTGCGTTCGCTGACGTGGAGGTTCTCGGACCAGCAGTGACCTTCAAAGTGAGCGCC
NM_130842.2       AGCAGTGCGTTCGCTGACGTGGAGGTTCTCGGACCAGCAGTGACCTTCAAAGTGAGCGCC
NM_130843.2       -------------------------------GACCAGCAGTGACCTTCAAAGTGAGCGCC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       AATGTCCAAAACGTGACCACTGAGGATGTGGAGAAGGCCACAGTTGACAACAAAGACAAA
NM_130842.2       AATGTCCAAAACGTGACCACTGAGGATGTGGAGAAGGCCACAGTTGACAACAAAGACAAA
NM_130843.2       AATGTCCAAAACGTGACCACTGAGGATGTGGAGAAGGCCACAGTTGACAACAAAGACAAA
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CTGGAGGAAACCTCTGGACTGAAAATTCTTCAAACCGGAGTCGGGTCGAAAAGCAAACTC
NM_130842.2       CTGGAGGAAACCTCTGGACTGAAAATTCTTCAAACCGGAGTCGGGTCGAAAAGCAAACTC
NM_130843.2       CTGGAGGAAACCTCTGGACTGAAAATTCTTCAAACCGGAGTCGGGTCGAAAAGCAAACTC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       AAGTTCCTGCCTCCTCAGGCGGAGCAAGAAGACTCCACCAAGTTCATCGCGCTCACCCTG
NM_130842.2       AAGTTCCTGCCTCCTCAGGCGGAGCAAGAAGACTCCACCAAGTTCATCGCGCTCACCCTG
NM_130843.2       AAGTTCCTGCCTCCTCAGGCGGAGCAAGAAGACTCCACCAAGTTCATCGCGCTCACCCTG
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GTCTCCCTCGCCTGCATCCTGGGCGTCCTCCTGGCCTCTGGCCTCATCTACTGCCTCCGC
NM_130842.2       GTCTCCCTCGCCTGCATCCTGGGCGTCCTCCTGGCCTCTGGCCTCATCTACTGCCTCCGC
NM_130843.2       GTCTCCCTCGCCTGCATCCTGGGCGTCCTCCTGGCCTCTGGCCTCATCTACTGCCTCCGC
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       CATAGCTCTCAGCACAGGCTGAAGGAGAAGCTCTCGGGACTAGGGGGCGACCCAGGTGCA
NM_130842.2       CATAGCTCTCAGCACAGGCTGAAGGAGAAGCTCTCGGGACTAGGGGGCGACCCAGGTGCA
NM_130843.2       CATAGCTCTCAGCACAGGCTGAAGGAGAAGCTCTCGGGACTAGGGGGCGACCCAGGTGCA
                                                                              

HsCD00297758      ------------------------------------------------------------
NM_002847.3       GATGCCACTGCCGCCTACCAGGAGCTGTGCCGCCAGCGTATGGCCACGCGGCCACCAGAC
NM_130842.2       GATGCCACTGCCGCCTACCAGGAGCTGTGCCGCCAGCGTATGGCCACGCGGCCACCAGAC
NM_130843.2       GATGCCACTGCCGCCTACCAGGAGCTGTGCCGCCAGCGTATGGCCACGCGGCCACCAGAC
                                                                              

HsCD00297758      -------------------------------------------------------TCTGA
NM_002847.3       CGACCTGAGGGCCCGCACACGTCACGCATCAGCAGCGTCTCATCCCAGTTCAGCGACGGG
NM_130842.2       CGACCTGAGGGCCCGCACACGTCACGCATCAGCAGCGTCTCATCCCAGTTCAGCGACGGG
NM_130843.2       CGACCTGAGGGCCCGCACACGTCACGCATCAGCAGCGTCTCATCCCAGTTCAGCGACGGG
                                                                         :* *.

HsCD00297758      ATATTTTGTTTAACTTTAGAAGGAGATATACATATGTCCCTTTCCGAGGAGCCTGTGCAG
NM_002847.3       CCGATCCCCAGCCCCTCCGCACGCAGCAGCGCCTCATCCTGGTCCGAGGAGCCTGTGCAG
NM_130842.2       CCGATCCCCAGCCCCTCCGCACGCAGCAGCGCCTCATCCTGGTCCGAGGAGCCTGTGCAG
NM_130843.2       CCGATCCCCAGCCCCTCCGCACGCAGCAGCGCCTCATCCTGGTCCGAGGAGCCTGTGCAG
                  . .:*    : ..* * .*.* *... * . . : .***   ******************

HsCD00297758      TCCAACATGGACATCTCCACCGGCCACATGATCCTGTCCTACATGGAGGACCACCTGAAG
NM_002847.3       TCCAACATGGACATCTCCACCGGCCACATGATCCTGTCCTACATGGAGGACCACCTGAAG
NM_130842.2       TCCAACATGGACATCTCCACCGGCCACATGATCCTGTCCTACATGGAGGACCACCTGAAG
NM_130843.2       TCCAACATGGACATCTCCACCGGCCACATGATCCTGTCCTACATGGAGGACCACCTGAAG
                  ************************************************************

HsCD00297758      AACAAGAACCGGCTGGAGAAGGAGTGGGAAGCGCTGTGCGCCTACCAGGCGGAGCCCAAC
NM_002847.3       AACAAGAACCGGCTGGAGAAGGAGTGGGAAGCGCTGTGCGCCTACCAGGCGGAGCCCAAC
NM_130842.2       AACAAGAACCGGCTGGAGAAGGAGTGGGAAGCGCTGTGCGCCTACCAGGCGGAGCCCAAC
NM_130843.2       AACAAGAACCGGCTGGAGAAGGAGTGGGAAGCGCTGTGCGCCTACCAGGCGGAGCCCAAC
                  ************************************************************

HsCD00297758      AGCTCGTTCGTGGCCCAGAGGGAGGAGAACGTGCCCAAGAACCGCTCCCTGGCTGTGCTG
NM_002847.3       AGCTCGTTCGTGGCCCAGAGGGAGGAGAACGTGCCCAAGAACCGCTCCCTGGCCGTGCTG
NM_130842.2       AGCTCGTTCGTGGCCCAGAGGGAGGAGAACGTGCCCAAGAACCGCTCCCTGGCCGTGCTG
NM_130843.2       AGCTCGTTCGTGGCCCAGAGGGAGGAGAACGTGCCCAAGAACCGCTCCCTGGCCGTGCTG
                  ***************************************************** ******

HsCD00297758      ACCTATGACCACTCCCGGGTCCTGCTGAAGGCGGAGAACAGCCACAGCCACTCAGACTAC
NM_002847.3       ACCTATGACCACTCCCGGGTCCTGCTGAAGGCGGAGAACAGCCACAGCCACTCAGACTAC
NM_130842.2       ACCTATGACCACTCCCGGGTCCTGCTGAAGGCGGAGAACAGCCACAGCCACTCAGACTAC
NM_130843.2       ACCTATGACCACTCCCGGGTCCTGCTGAAGGCGGAGAACAGCCACAGCCACTCAGACTAC
                  ************************************************************

HsCD00297758      ATCAACGCTAGCCCTATCATGGATCACGACCCGAGGAACCCGGCGTACATCGCCACCCAG
NM_002847.3       ATCAACGCTAGCCCCATCATGGATCACGACCCGAGGAACCCCGCGTACATCGCCACCCAG
NM_130842.2       ATCAACGCTAGCCCCATCATGGATCACGACCCGAGGAACCCCGCGTACATCGCCACCCAG
NM_130843.2       ATCAACGCTAGCCCCATCATGGATCACGACCCGAGGAACCCCGCGTACATCGCCACCCAG
                  ************** ************************** ******************

HsCD00297758      GGACCGCTGCCCGCCACCGTGGCTGACTTTTGGCAGATGGTGTGGGAGAGCGGCTGCGTG
NM_002847.3       GGACCGCTGCCCGCCACCGTGGCTGACTTTTGGCAGATGGTGTGGGAGAGCGGCTGCGTG
NM_130842.2       GGACCGCTGCCCGCCACCGTGGCTGACTTTTGGCAGATGGTGTGGGAGAGCGGCTGCGTG
NM_130843.2       GGACCGCTGCCCGCCACCGTGGCTGACTTTTGGCAGATGGTGTGGGAGAGCGGCTGCGTG
                  ************************************************************

HsCD00297758      GTGATCGTCATGCTGACACCCCTCGCGGAGAACGGCGTCCGGCAGTGCTACCACTACTGG
NM_002847.3       GTGATCGTCATGCTGACACCCCTCGCGGAGAACGGCGTCCGGCAGTGCTACCACTACTGG
NM_130842.2       GTGATCGTCATGCTGACACCCCTCGCGGAGAACGGCGTCCGGCAGTGCTACCACTACTGG
NM_130843.2       GTGATCGTCATGCTGACACCCCTCGCGGAGAACGGCGTCCGGCAGTGCTACCACTACTGG
                  ************************************************************

HsCD00297758      CCGGATGAAGGCTCCAATCTCTACCACATCTATGAGGTGAACCTGGTCTCCGAGCACATC
NM_002847.3       CCGGATGAAGGCTCCAATCTCTACCACATCTATGAGGTGAACCTGGTCTCCGAGCACATC
NM_130842.2       CCGGATGAAGGCTCCAATCTCTACCACATCTATGAGGTGAACCTGGTCTCCGAGCACATC
NM_130843.2       CCGGATGAAGGCTCCAATCTCTACCACATCTATGAGGTGAACCTGGTCTCCGAGCACATC
                  ************************************************************

HsCD00297758      TGGTGTGAGGACTTCCTGGTGAGGAGCTTCTATCTGAAGAACCTGCAGACCAACGAGACG
NM_002847.3       TGGTGTGAGGACTTCCTGGTGAGGAGCTTCTATCTGAAGAACCTGCAGACCAACGAGACG
NM_130842.2       TGGTGTGAGGACTTCCTGGTGAGGAGCTTCTATCTGAAGAACCTGCAGACCAACGAGACG
NM_130843.2       TGGTGTGAGGACTTCCTGGTGAGGAGCTTCTATCTGAAGAACCTGCAGACCAACGAGACG
                  ************************************************************

HsCD00297758      CGCACCGTGACGCAGTTCCACTTCCTGAGTTGGTATGACCGAGGAGTCCCTTCCTCCTCA
NM_002847.3       CGCACCGTGACGCAGTTCCACTTCCTGAGTTGGTATGACCGAGGAGTCCCTTCCTCCTCA
NM_130842.2       CGCACCGTGACGCAGTTCCACTTCCTGAGTTGGTATGACCGAGGAGTCCCTTCCTCCTCA
NM_130843.2       CGCACCGTGACGCAGTTCCACTTCCTGAGTTGGTATGACCGAGGAGTCCCTTCCTCCTCA
                  ************************************************************

HsCD00297758      AGGTCCCTCCTGGACTTCCGCAGAAAAGTAAACAAGTGCTACAGGGGCCGTTCTTGTCCA
NM_002847.3       AGGTCCCTCCTGGACTTCCGCAGAAAAGTAAACAAGTGCTACAGGGGCCGTTCTTGTCCA
NM_130842.2       AGGTCCCTCCTGGACTTCCGCAGAAAAGTAAACAAGTGCTACAGGGGCCGTTCTTGTCCA
NM_130843.2       AGGTCCCTCCTGGACTTCCGCAGAAAAGTAAACAAGTGCTACAGGGGCCGTTCTTGTCCA
                  ************************************************************

HsCD00297758      ATAATTGTTCATTGCAGTGACGGTGCAGGCCGGAGCGGCACCTACGTCCTGATCGACATG
NM_002847.3       ATAATTGTTCATTGCAGTGACGGTGCAGGCCGGAGCGGCACCTACGTCCTGATCGACATG
NM_130842.2       ATAATTGTTCATTGCAGTGACGGTGCAGGCCGGAGCGGCACCTACGTCCTGATCGACATG
NM_130843.2       ATAATTGTTCATTGCAGTGACGGTGCAGGCCGGAGCGGCACCTACGTCCTGATCGACATG
                  ************************************************************

HsCD00297758      GTTCTCAACAAGATGGCCAAAGGTGCTAAAGAGATTGATATCGCAGCGACCCTGGAGCAC
NM_002847.3       GTTCTCAACAAGATGGCCAAAGGTGCTAAAGAGATTGATATCGCAGCGACCCTGGAGCAC
NM_130842.2       GTTCTCAACAAGATGGCCAAAGGTGCTAAAGAGATTGATATCGCAGCGACCCTGGAGCAC
NM_130843.2       GTTCTCAACAAGATGGCCAAAGGTGCTAAAGAGATTGATATCGCAGCGACCCTGGAGCAC
                  ************************************************************

HsCD00297758      TTGAGGGACCAGAGACCCGGCATGGTCCAGACGAAGGAGCAGTTTGAGTTCGCGCTGACA
NM_002847.3       TTGAGGGACCAGAGACCCGGCATGGTCCAGACGAAGGAGCAGTTTGAGTTCGCGCTGACA
NM_130842.2       TTGAGGGACCAGAGACCCGGCATGGTCCAGACGAAGGAGCAGTTTGAGTTCGCGCTGACA
NM_130843.2       TTGAGGGACCAGAGACCCGGCATGGTCCAGACGAAGGAGCAGTTTGAGTTCGCGCTGACA
                  ************************************************************

HsCD00297758      GCCGTGGCTGAGGAGGTGAACGCCATCCTCAAGGCCCTTCCCCAGGAAGGGCATCATCAC
NM_002847.3       GCCGTGGCTGAGGAGGTGAACGCCATCCTCAAGGCCCTTCCCCAGTGA------------
NM_130842.2       GCCGTGGCTGAGGAGGTGAACGCCATCCTCAAGGCCCTTCCCCAGTGA------------
NM_130843.2       GCCGTGGCTGAGGAGGTGAACGCCATCCTCAAGGCCCTTCCCCAGTGA------------
                  ********************************************* .*            

HsCD00297758      CATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCA
NM_002847.3       ------------------------------------------------------------
NM_130842.2       ------------------------------------------------------------
NM_130843.2       ------------------------------------------------------------
                                                                              

HsCD00297758      C
NM_002847.3       -
NM_130842.2       -
NM_130843.2       -
                   

Protein

SMART domain : PTPc : Protein tyrosine phosphatase, catalytic domain
SMART domain : PTPc_motif : Protein tyrosine phosphatase, catalytic domain motif
Structural Annotation Wiki : TOPSAN
UniProt : Q92932
UniProt : Q9Y4I6
UniProt : E9PC57
HPRD : 03413

Clone

Cloning Information : 495320
HIP Master Clone ID : 409000
Original Clone ID : 8621a8BCt8p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8621a

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 7
Map Location : 7q36
Ensembl : ENSG00000155093

Reagents

Labome : PTPRN2-antibody