DNASU Plasmid Repository • 480.965.5697 | Email

TGFB1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TGFB1
Gene Name:  transforming growth factor, beta 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127801.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002986

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1173nts         Open reading frame : 1 to 1173
Reference Sequence Alignment

ATGCCGCCCTCCGGGCTGCGGCTGCTGCTGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
AACATGATCGTGCGCTCCTGCAAGTGCAGCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1619
Start on reference sequence 447
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TGFB1
Symbol Nomenclature : TGFB1
SYNONYM : CED; DPD1; LAP; TGFB; TGFbeta
Designation : TGF-beta-1|latency-associated peptide|prepro-transforming growth factor beta-1|transforming growth factor beta-1
Full Nomenclature : transforming growth factor, beta 1
GENEID : 7040
GI : 60818349
GenBank Accession : AY893424
HGNC : 11766
MIM : 190180
Target GenBank: BC000125

 

Reference Sequence Alignment

  

HsCD00002986      ATGCCGCCCTCCGGGCTGCGGCTGCTGCTGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
NM_000660.5       ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
                  **************************** *******************************

HsCD00002986      CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
NM_000660.5       CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
                  ************************************************************

HsCD00002986      GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
NM_000660.5       GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
                  ************************************************************

HsCD00002986      AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
NM_000660.5       AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
                  ************************************************************

HsCD00002986      TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
NM_000660.5       TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
                  ************************************************************

HsCD00002986      GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
NM_000660.5       GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
                  ************************************************************

HsCD00002986      TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
NM_000660.5       TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
                  ************************************************************

HsCD00002986      CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
NM_000660.5       CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
                  ************************************************************

HsCD00002986      AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
NM_000660.5       AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
                  ************************************************************

HsCD00002986      TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
NM_000660.5       TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
                  ************************************************************

HsCD00002986      ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
NM_000660.5       ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
                  ************************************************************

HsCD00002986      GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
NM_000660.5       GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
                  ************************************************************

HsCD00002986      ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
NM_000660.5       ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
                  ************************************************************

HsCD00002986      ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
NM_000660.5       ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
                  ************************************************************

HsCD00002986      GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
NM_000660.5       GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
                  ************************************************************

HsCD00002986      GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
NM_000660.5       GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
                  ************************************************************

HsCD00002986      TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
NM_000660.5       TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
                  ************************************************************

HsCD00002986      GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
NM_000660.5       GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
                  ************************************************************

HsCD00002986      CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
NM_000660.5       CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
                  ************************************************************

HsCD00002986      AACATGATCGTGCGCTCCTGCAAGTGCAGCTGA
NM_000660.5       AACATGATCGTGCGCTCCTGCAAGTGCAGCTGA
                  *********************************

Pathways

NCI : ALK1 signaling events
NCI : AP-1 transcription factor network
NCI : Glypican 1 network
NCI : IL12 signaling mediated by STAT4
NCI : IL27-mediated signaling events
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Regulation of Telomerase
NCI : Syndecan-1-mediated signaling events
NCI : Syndecan-2-mediated signaling events
NCI : TGF-beta receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Host Interactions with Influenza Factors
Reactome : Influenza Infection
Reactome : Influenza Virus Induced Apoptosis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Molecules associated with elastic fibres
Reactome : Non-integrin membrane-ECM interactions
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Syndecan interactions
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : ACE Inhibitor Pathway
WikiPathway : Adipogenesis
WikiPathway : Cell cycle
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Endochondral Ossification
WikiPathway : Epithelium TarBase
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Proteins and DNA Sequences in Cardicac Structures
WikiPathway : Senescence and Autophagy
WikiPathway : Squamous cell TarBase
WikiPathway : TCR Signaling Pathway
WikiPathway : TFs Regulate miRNAs related to cardiac hypertrophy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway

Protein

SMART domain : TGFB : Transforming growth factor-beta (TGF-beta) family
UniProt : P01137
HPRD : 01821

Clone

Cloning Information : 127801
HIP Master Clone ID : 103950
Original Clone ID : FLH127801.01X

Organism


TAX_ID : 9606
Species Specific ID: 7040

Genome

Chromosome : 19
Map Location : 19q13.1

Reagents

Labome : TGF-beta1-antibody