DNASU Plasmid Repository • 480.965.5697 | Email

PRKACB (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKACB
Gene Name:  protein kinase, cAMP-dependent, catalytic, beta
Sequence             
Original Clone ID: FLH230761.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00298627

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1197nts         Open reading frame : 1 to 1197
Reference Sequence Alignment

ATGGCAGCTTATAGAGAACCACCTTGTAACCAGTATACAGGTACAACTACAGCTCTTCAG
AAATTGGAAGGTTTTGCTAGCCGGTTATTTCATAGACACTCTAAAGGTACTGCACATGAT
CAGAAAACAGCTCTGGAAAATGACAGCCTTCATTTCTCTGAACATACTGCCTTATGGGAC
AGATCAATGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAAT
CCAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGT
TCATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTGAACAGTATTATGCCATGAAG
ATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAA
AGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGAT
AATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTA
AGAAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTA
ACATTCGAGTACCTCCATTCACTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTC
TTAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAA
GGCAGAACTTGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAATAATTCTCAGC
AAGGGCTACAATAAGGCAGTGGATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCA
GCTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTTATGAAAAGATTGTTTCT
GGAAAGGTCCGATTCCCATCCCACTTCAGTTCAGATCTCAAGGACCTTCTACGGAACCTG
CTGCAGGTGGATTTGACCAAGAGATTTGGAAATCTAAAGAATGGTGTCAGTGATATAAAA
ACTCACAAGTGGTTTGCCACGACAGATTGGATTGCTATTTACCAGAGGAAGGTTGAAGCT
CCATTCATACCAAAGTTTAGAGGCTCTGGAGATACCAGCAACTTTGATGACTATGAAGAA
GAAGATATCCGTGTCTCTATAACAGAAAAATGTGCAAAAGAATTTGGTGAATTTTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1288
Start on reference sequence 92
Mutations:
None
Discrepancy:
c849t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKACB
Symbol Nomenclature : PRKACB
SYNONYM : PKACB
Designation : PKA C-beta|cAMP-dependent protein kinase catalytic beta subunit isoform 4ab|cAMP-dependent protein kinase catalytic subunit beta|protein kinase A catalytic subunit beta
Full Nomenclature : protein kinase, cAMP-dependent, catalytic, beta
GENEID : 5567
Locus Tag : RP11-82H13.1
HGNC : 9381
MIM : 176892
Vega : OTTHUMG00000009975
Target GenBank: NM_182948

 

Reference Sequence Alignment

  

HsCD00298627        -----------------------------------------------------------A
NM_182948.2         -----------------------------------------------------------A
XM_005259984.1      ATGTTCACCTTGGGATACCATGGGGCCGAGGAGTGGGCATCGGGCGAGACTTCCCTTGAA
                                                                               *

HsCD00298627        TGGCAGCTTATAGAGAACCACCTTGTAACCAGTATACAGGTACAACTACAGCTCTTCAGA
NM_182948.2         TGGCAGCTTATAGAGAACCACCTTGTAACCAGTATACAGGTACAACTACAGCTCTTCAGA
XM_005259984.1      CCAGCTCTGGAGCAATGCCCTTGCGATTGCCACGGAGAGGAACAGGGCCAGCTGGGGGCC
                      . . ** .:. *.:.**.    *::: *.. . * ***:***.  .*****    . .

HsCD00298627        AATTGGAAGGTTTTGCTAGCCGGTTATTTCATAGACACTCTAAAGGTACTGCACATGATC
NM_182948.2         AATTGGAAGGTTTTGCTAGCCGGTTATTTCATAGACACTCTAAAGGTACTGCACATGATC
XM_005259984.1      AAGGTGACAGCTGAGCCCCCCAAGGGCACCTGCTACCCGAGCCCCCGAGGCCTCCATCCC
                    **   **..* * :** . **..  . : *: . **.* . ...   *   *:*.: . *

HsCD00298627        AG----------------------------AAAACAGCTCTGGAAAATGACAGCCTTCAT
NM_182948.2         AG----------------------------AAAACAGCTCTGGAAAATGACAGCCTTCAT
XM_005259984.1      AGGCCCGGCCTCCCCAGAGAAGGGGCCAGAGGAACAGCCAAATCCCAAGGCTATAAATAC
                    **                            ..****** .:. ...*:*.*:. .:: * 

HsCD00298627        TTCTCTGAACATACTGCCTTATGGGACAGATCAATGAAAGAGTTTCTAGCCAAAGCCAAA
NM_182948.2         TTCTCTGAACATACTGCCTTATGGGACAGATCAATGAAAGAGTTTCTAGCCAAAGCCAAA
XM_005259984.1      CTCGGCTGGCGTCGGCCCTGGCCATGGAATGTCGTGAAAGAATTCTTAGCCAAAGCCAAA
                     **    ..*.*.   *** .  . . *.:  ..*******.**  **************

HsCD00298627        GAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTT
NM_182948.2         GAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTT
XM_005259984.1      GAAGATTTTCTTAAAAAATGGGAAAGTCCCGCTCAGAACACAGCCCACTTGGATCAGTTT
                    ***** *** * ***********.*.***..******* *.:*** .. * **: * ***

HsCD00298627        GAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAA
NM_182948.2         GAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAA
XM_005259984.1      GAACGAATCAAGACCCTCGGCACGGGCTCCTTCGGGCGGGTGATGCTGGTGAAACACAAG
                    ***.*.*:.**.***** **.**.** **.** **..*.** *** ****.********.

HsCD00298627        GCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAG
NM_182948.2         GCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAG
XM_005259984.1      GAGACCGGGAACCACTATGCCATGAAGATCCTCGACAAACAGAAGGTGGTGAAACTGAAA
                    *. ** *...*  * *************** *.** **.******** ** ********.

HsCD00298627        CAAATAGAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTT
NM_182948.2         CAAATAGAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTT
XM_005259984.1      CAGATCGAACACACCCTGAATGAAAAGCGCATCCTGCAAGCTGTCAACTTTCCGTTCCTC
                    **.**.**.** **  *******.**..*.**. *.**.**:** ** ***** ***** 

HsCD00298627        GTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTC
NM_182948.2         GTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTC
XM_005259984.1      GTCAAACTCGAGTTCTCCTTCAAGGACAACTCAAACTTATACATGGTCATGGAGTACGTG
                    ** ..*** ****:  * ** ***** ** **:** *********** *****.** ** 

HsCD00298627        CCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGTGAGCCCCATGCA
NM_182948.2         CCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGTGAGCCCCATGCA
XM_005259984.1      CCCGGCGGGGAGATGTTCTCACACCTACGGCGGATCGGAAGGTTCAGTGAGCCCCATGCC
                    ** ** ** **.***** ***** ***.*..*.** ***********************.

HsCD00298627        CGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCCATTCACTAGACCTCATC
NM_182948.2         CGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCCATTCACTAGACCTCATC
XM_005259984.1      CGTTTCTACGCGGCCCAGATCGTCCTGACCTTTGAGTATCTGCACTCGCTGGATCTCATC
                    ** ***** **.** *****.** **.**.** ***** ** ** **.**.** ******

HsCD00298627        TACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATATCCAGGTCACA
NM_182948.2         TACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATATCCAGGTCACA
XM_005259984.1      TACAGGGACCTGAAGCCGGAGAATCTGCTCATTGACCAGCAGGGCTACATTCAGGTGACA
                    *****.** **.**.** **.*****  *.******** **.***** ** ***** ***

HsCD00298627        GACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAG
NM_182948.2         GACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAG
XM_005259984.1      GACTTCGGTTTCGCCAAGCGCGTGAAGGGCCGCACTTGGACCTTGTGCGGCACCCCTGAG
                    ***** ** ** *****..*.** **.***.*.********.**.** **.** **:***

HsCD00298627        TATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCA
NM_182948.2         TATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCA
XM_005259984.1      TACCTGGCCCCTGAGATTATCCTGAGCAAAGGCTACAACAAGGCCGTGGACTGGTGGGCC
                    **  **** **:**.**:** ** *****.******** *****.***** ********.

HsCD00298627        TTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGACCAACCA
NM_182948.2         TTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGACCAACCA
XM_005259984.1      CTGGGGGTTCTTATCTATGAAATGGCCGCTGGCTACCCGCCCTTCTTCGCAGACCAGCCC
                     *.**.** **:**************.******** ** **.***** ********.**.

HsCD00298627        ATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCGATTCCCATCCCACTTCAGTTCA
NM_182948.2         ATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCGATTCCCATCCCACTTCAGTTCA
XM_005259984.1      ATCCAGATCTATGAGAAGATCGTCTCTGGGAAGGTGCGCTTCCCTTCCCACTTCAGCTCT
                    ** ***** *****.***** ** *****.***** **.*****:*********** **:

HsCD00298627        GATCTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAGAGATTTGGAAAT
NM_182948.2         GATCTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAGAGATTTGGAAAT
XM_005259984.1      GACTTGAAGGACCTGCTGCGGAACCTCCTGCAGGTAGATCTCACCAAGCGCTTTGGGAAC
                    **  * ******** **.******** ********.*** * ******.*.*****.** 

HsCD00298627        CTAAAGAATGGTGTCAGTGATATAAAAACTCACAAGTGGTTTGCCACGACAGATTGGATT
NM_182948.2         CTAAAGAATGGTGTCAGTGATATAAAAACTCACAAGTGGTTTGCCACGACAGATTGGATT
XM_005259984.1      CTCAAGAATGGGGTCAACGATATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATT
                    **.******** ****. *****.**.*. *****************.**:** ******

HsCD00298627        GCTATTTACCAGAGGAAGGTTGAAGCTCCATTCATACCAAAGTTTAGAGGCTCTGGAGAT
NM_182948.2         GCTATTTACCAGAGGAAGGTTGAAGCTCCATTCATACCAAAGTTTAGAGGCTCTGGAGAT
XM_005259984.1      GCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGAT
                    ** ** ************** ********.****************.**** ****.***

HsCD00298627        ACCAGCAACTTTGATGACTATGAAGAAGAAGATATCCGTGTCTCTATAACAGAAAAATGT
NM_182948.2         ACCAGCAACTTTGATGACTATGAAGAAGAAGATATCCGTGTCTCTATAACAGAAAAATGT
XM_005259984.1      ACGAGTAACTTTGACGACTATGAGGAAGAAGAAATCCGGGTCTCCATCAATGAGAAGTGT
                    ** ** ******** ********.********:***** ***** **.*.:**.**.***

HsCD00298627        GCAAAAGAATTTGGTGAATTTTTG
NM_182948.2         GCAAAAGAATTTGGTGAATTTTAA
XM_005259984.1      GGCAAGGAGTTTTCTGAGTTTTAG
                    * .**.**.***  ***.****:.

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : IL3-mediated signaling events
NCI : p73 transcription factor network
Panther : 5HT1 type receptor mediated signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Endothelin signaling pathway
Panther : Enkephalin release
Panther : GABA-B receptor II signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-rod outer segment phototransduction
Panther : Histamine H2 receptor mediated signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group I pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Aquaporin-mediated transport
Reactome : CREB phosphorylation through the activation of Adenylate Cyclase
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : Cytokine Signaling in Immune system
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DARPP-32 events
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G-protein mediated events
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Gluconeogenesis
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Hemostasis
Reactome : Hormone-sensitive lipase (HSL)-mediated triacylglycerol hydrolysis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Lipid digestion, mobilization, and transport
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of lipids and lipoproteins
Reactome : Myoclonic epilepsy of Lafora
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PKA-mediated phosphorylation of key metabolic factors
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Post NMDA receptor activation events
Reactome : Rap1 signalling
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : AMPK signaling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 230761
HIP Master Clone ID : 136144
Original Clone ID : FLH230761.01L

Organism


TAX_ID : 9606
Species Specific ID: 5567

Genome

Chromosome : 1
Map Location : 1p31.1
Ensembl : ENSG00000142875

Reagents

Labome : PRKACB-antibody