DNASU Plasmid Repository • 480.965.5697 | Email

PIK4CB (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PI4KB
Gene Name:  phosphatidylinositol 4-kinase, catalytic, beta
Sequence             
Original Clone ID: FLH231769.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00299070

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2406nts        
Open reading frame : 1 to 2406
Reference Sequence Alignment

ATGGGAGATACAGTAGTGGAGCCTGCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGC
CCACCAGGGAATAATGGGGGGTCCCTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTA
TCAGTGATTGACCCTGAGGTGGCCCAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAG
CTTTTGCATGGAGGCGTGGCAGTCTCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGG
GATGGTGTGGACAGTGAGATCCGTTGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAG
GAAGATGAGATGGGGGCCGCTGTGGCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGG
CAGAACAACTCAGCTAAACAGTCTTGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGAC
ATCTCCATGGCCATTTCATACCTGTATAACTCCAAGGAGCCTGGAGTACAAGCCTACATT
GGCAACCGGCTCTTCTGCTTTCGCAACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTT
AACATGTACATCCACATGGATGAGGACGTGGGTGATGCCATTAAGCCCTACATAGTCCAC
CGTTGCCGCCAGAGCATTAACTTTTCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCT
TCAGACATGCACATTTCCACTCAACGACACTCCCGTGGGACCAAGCTACGGAAGCTGATC
CTCTCAGATGAGCTAAAGCCAGCTCACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCC
CCTGATACAGGGCTGTCTCCCTCCAAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACT
GCCAGCATAAGTCTCAGCAGCAACCTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAAT
GAGGATGAGCCTGTTCGACTGGCTCCTGAGAGAGAATTCATCAAGTCCCTGATGGCGATC
GGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAAACACAGAGGCTGATCTCAGAG
CTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGGCTGCCCACTGCTGGCTTTGAC
CACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTCCTCAACTCCAAGGACAAGGCT
CCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAACTTTGACACCACCAGTGTCCCT
GCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCCGTAGAAAACTTGCCCGAATGT
GGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACTGTGCCCAACTATGACAACGAT
GATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAAGTGGAGCTCCCCGAAGTGCAT
ACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGACAGCATCACCAGCCAGGAGAGC
AAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGGCGCCTTTCGGAACAGCTGGCT
CATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCTTCTGCAGTTGCTCTCAAAGAG
CCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCCCCCTACGGCCATCTCCCCAAT
TGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGACCTTCGGCAAGAGCTTCTGGCC
TTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAGGAGCGAGTGCCCCTTTGGATC
AAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGCATGATTGAACCAGTGGTCAAT
GCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTCTCCTTGCTCGATTACTTCCTA
CAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGTGCACAGCGCAATTTTGTGCAA
AGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAAGTCAAGGACAGACACAATGGG
AATATCCTTTTGGACGCAGAAGGCCACATCATCCACATCGACTTTGGCTTCATCCTCTCC
AGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTTAAGCTGACCACAGAGTTTGTG
GATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTACTATAAGATGCTGATGCTGCAA
GGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTGCAGATCGTGGAGATCATGCAG
CAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACCATTCGAAACCTCAAAGAGAGG
TTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTGGTGGAGCAGATGGTGGATGGC
AGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTCCAGTACCTCACCAACGGCATC
ATGGTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
Start on reference sequence 163
End on reference sequence 2568
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PI4KB
Symbol Nomenclature : PI4KB
SYNONYM : NPIK; PI4K-BETA; PI4K92; PI4KBETA; PI4KIIIBETA; PIK4CB
Designation : PtdIns 4-kinase beta|phosphatidylinositol 4-kinase beta|phosphatidylinositol 4-kinase, wortmannin-sensitive|type III phosphatidylinositol 4-kinase beta
Full Nomenclature : phosphatidylinositol 4-kinase, catalytic, beta
GENEID : 5298
Locus Tag : RP11-126K1.4
HGNC : 8984
MIM : 602758
Vega : OTTHUMG00000012348
Target GenBank: BC000029

 

Reference Sequence Alignment

  

HsCD00299070        ------------------------------------ATGGGAGATACAGTAGTGGAGCCT
NM_002651.2         ATGAGATTCTTGGAAGCTCGAAGTCTGGCTGTGGCCATGGGAGATACAGTAGTGGAGCCT
NM_001198774.1      ------------------------------------ATGGGAGATACAGTAGTGGAGCCT
NM_001198773.1      ------------------------------------ATGGGAGATACAGTAGTGGAGCCT
                                                        ************************

HsCD00299070        GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_002651.2         GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_001198774.1      GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_001198773.1      GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
                    ************************************************************

HsCD00299070        CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_002651.2         CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_001198774.1      CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_001198773.1      CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
                    ************************************************************

HsCD00299070        CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_002651.2         CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_001198774.1      CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_001198773.1      CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
                    ************************************************************

HsCD00299070        TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_002651.2         TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_001198774.1      TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_001198773.1      TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
                    ************************************************************

HsCD00299070        TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_002651.2         TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_001198774.1      TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_001198773.1      TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
                    ************************************************************

HsCD00299070        GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_002651.2         GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_001198774.1      GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_001198773.1      GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
                    ************************************************************

HsCD00299070        TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_002651.2         TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_001198774.1      TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_001198773.1      TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
                    ************************************************************

HsCD00299070        TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_002651.2         TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_001198774.1      TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_001198773.1      TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
                    ************************************************************

HsCD00299070        AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_002651.2         AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_001198774.1      AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_001198773.1      AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
                    ************************************************************

HsCD00299070        GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_002651.2         GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_001198774.1      GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_001198773.1      GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
                    ************************************************************

HsCD00299070        TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_002651.2         TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_001198774.1      TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_001198773.1      TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
                    ************************************************************

HsCD00299070        CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_002651.2         CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_001198774.1      CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_001198773.1      CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
                    ************************************************************

HsCD00299070        CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGATACAGGGCTGTCTCCCTCC
NM_002651.2         CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
NM_001198774.1      CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
NM_001198773.1      CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
                    ***************************************** ******************

HsCD00299070        AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_002651.2         AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_001198774.1      AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_001198773.1      AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
                    ************************************************************

HsCD00299070        CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAG---------------
NM_002651.2         CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAGGAGCTCTCCTCCAGC
NM_001198774.1      CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAG---------------
NM_001198773.1      CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAG---------------
                    *********************************************               

HsCD00299070        ------------------------------CCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_002651.2         ACCGAGAGTATTGATAATTCATTCAGTTCCCCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_001198774.1      ------------------------------CCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_001198773.1      ------------------------------CCTGTTCGACTGGCTCCTGAGAGAGAATTC
                                                  ******************************

HsCD00299070        ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_002651.2         ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_001198774.1      ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_001198773.1      ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
                    ************************************************************

HsCD00299070        ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_002651.2         ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_001198774.1      ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_001198773.1      ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
                    ************************************************************

HsCD00299070        CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_002651.2         CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_001198774.1      CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_001198773.1      CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
                    ************************************************************

HsCD00299070        CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_002651.2         CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_001198774.1      CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_001198773.1      CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
                    ************************************************************

HsCD00299070        TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_002651.2         TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_001198774.1      TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_001198773.1      TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
                    ************************************************************

HsCD00299070        GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_002651.2         GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_001198774.1      GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_001198773.1      GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
                    ************************************************************

HsCD00299070        GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_002651.2         GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_001198774.1      GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_001198773.1      GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
                    ************************************************************

HsCD00299070        GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_002651.2         GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_001198774.1      GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_001198773.1      GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
                    ************************************************************

HsCD00299070        AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_002651.2         AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_001198774.1      AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_001198773.1      AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
                    ************************************************************

HsCD00299070        CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_002651.2         CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_001198774.1      CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_001198773.1      CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
                    ************************************************************

HsCD00299070        TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_002651.2         TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_001198774.1      TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_001198773.1      TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
                    ************************************************************

HsCD00299070        CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_002651.2         CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_001198774.1      CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_001198773.1      CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
                    ************************************************************

HsCD00299070        CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_002651.2         CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_001198774.1      CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_001198773.1      CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
                    ************************************************************

HsCD00299070        GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_002651.2         GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_001198774.1      GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_001198773.1      GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
                    ************************************************************

HsCD00299070        ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_002651.2         ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_001198774.1      ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_001198773.1      ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
                    ************************************************************

HsCD00299070        TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_002651.2         TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_001198774.1      TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_001198773.1      TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
                    ************************************************************

HsCD00299070        GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_002651.2         GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_001198774.1      GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_001198773.1      GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
                    ************************************************************

HsCD00299070        GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_002651.2         GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_001198774.1      GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_001198773.1      GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
                    ************************************************************

HsCD00299070        GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_002651.2         GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_001198774.1      GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_001198773.1      GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
                    ************************************************************

HsCD00299070        AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_002651.2         AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_001198774.1      AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_001198773.1      AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
                    ************************************************************

HsCD00299070        TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_002651.2         TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_001198774.1      TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_001198773.1      TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
                    ************************************************************

HsCD00299070        CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_002651.2         CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_001198774.1      CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_001198773.1      CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
                    ************************************************************

HsCD00299070        ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_002651.2         ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_001198774.1      ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_001198773.1      ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
                    ************************************************************

HsCD00299070        GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_002651.2         GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_001198774.1      GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_001198773.1      GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
                    ************************************************************

HsCD00299070        CAGTACCTCACCAACGGCATCATGGTG
NM_002651.2         CAGTACCTCACCAACGGCATCATGTGA
NM_001198774.1      CAGTACCTCACCAACGGCATCATGTGA
NM_001198773.1      CAGTACCTCACCAACGGCATCATGTGA
                    ************************  .

Pathways

NCI : Integrins in angiogenesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the Golgi membrane

Protein

SMART domain : PI3Kc : Phosphoinositide 3-kinase, catalytic domain
UniProt : Q9UBF8
HPRD : 11805

Clone

Cloning Information : 231769
HIP Master Clone ID : 87408
Original Clone ID : FLH231769.01L

Organism


TAX_ID : 9606
Species Specific ID: 5298

Genome

Chromosome : 1
Map Location : 1q21
Ensembl : ENSG00000143393

Reagents

Labome : PI4KB-antibody