DNASU Plasmid Repository • 480.965.5697 | Email

CKMT2 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CKMT2
Gene Name:  creatine kinase, mitochondrial 2 (sarcomeric)
Sequence             
Original Clone ID: FLH231873.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00299536

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1260nts         Open reading frame : 1 to 1260
Reference Sequence Alignment

ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACC
ATGGGCACCAGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAG
GTCCGGGAGCAGCCTAGGCTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCAC
AACAACTGCATGGCCGAGTGCCTCACCCCCGCCATTTATGCCAAGCTTCGCAACAAGGTG
ACACCCAACGGCTACACGCTGGACCAGTGCATCCAGACTGGAGTGGACAACCCTGGCCAC
CCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCCTATGAGGTGTTTGCT
GACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTGATGAAG
CACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTG
CTGTCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGC
ACCCGGGCCGAGCGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAG
GGGGACCTGGCTGGCCGCTACTACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGG
CTCATCGATGACCACTTTCTGTTTGATAAGCCAGTGTCCCCTTTATTAACATGTGCTGGG
ATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCATAATTATGATAAGACATTTCTC
ATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAAGGAGGCAATATG
AAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAAGAA
CGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAAC
CTTGGAACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCA
CGCTTTTCTAAGATCCTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGAC
ACTGCCGCGGTCGCAGATGTGTACGACATTTCCAACATAGATAGAATTGGTCGATCAGAG
GTTGAGCTTGTTCAGATAGTCATCGATGGAGTCAATTACCTGGTGGATTGTGAAAAGAAG
TTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCTCAGTTTGGCAAAAAGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1458
Start on reference sequence 199
Mutations:
None
Discrepancy:
t220g,S74A
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CKMT2
Symbol Nomenclature : CKMT2
SYNONYM : SMTCK
Designation : S-MtCK|basic-type mitochondrial creatine kinase|creatine kinase S-type, mitochondrial|mib-CK|sarcomeric mitochondrial creatine kinase
Full Nomenclature : creatine kinase, mitochondrial 2 (sarcomeric)
GENEID : 1160
HGNC : 1996
MIM : 123295
Vega : OTTHUMG00000119013
Target GenBank: NM_001825

 

Reference Sequence Alignment

  

HsCD00299536        ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACC
NM_001099736.1      ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACC
NM_001825.2         ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACC
NM_001099735.1      ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACC
                    ************************************************************

HsCD00299536        ATGGGCACCAGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAG
NM_001099736.1      ATGGGCACCAGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAG
NM_001825.2         ATGGGCACCAGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAG
NM_001099735.1      ATGGGCACCAGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAG
                    ************************************************************

HsCD00299536        GTCCGGGAGCAGCCTAGGCTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCAC
NM_001099736.1      GTCCGGGAGCAGCCTAGGCTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCAC
NM_001825.2         GTCCGGGAGCAGCCTAGGCTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCAC
NM_001099735.1      GTCCGGGAGCAGCCTAGGCTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCAC
                    ************************************************************

HsCD00299536        AACAACTGCATGGCCGAGTGCCTCACCCCCGCCATTTATGCCAAGCTTCGCAACAAGGTG
NM_001099736.1      AACAACTGCATGGCCGAGTGCCTCACCCCCGCCATTTATGCCAAGCTTCGCAACAAGGTG
NM_001825.2         AACAACTGCATGGCCGAGTGCCTCACCCCCGCCATTTATGCCAAGCTTCGCAACAAGGTG
NM_001099735.1      AACAACTGCATGGCCGAGTGCCTCACCCCCGCCATTTATGCCAAGCTTCGCAACAAGGTG
                    ************************************************************

HsCD00299536        ACACCCAACGGCTACACGCTGGACCAGTGCATCCAGACTGGAGTGGACAACCCTGGCCAC
NM_001099736.1      ACACCCAACGGCTACACGCTGGACCAGTGCATCCAGACTGGAGTGGACAACCCTGGCCAC
NM_001825.2         ACACCCAACGGCTACACGCTGGACCAGTGCATCCAGACTGGAGTGGACAACCCTGGCCAC
NM_001099735.1      ACACCCAACGGCTACACGCTGGACCAGTGCATCCAGACTGGAGTGGACAACCCTGGCCAC
                    ************************************************************

HsCD00299536        CCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCCTATGAGGTGTTTGCT
NM_001099736.1      CCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCCTATGAGGTGTTTGCT
NM_001825.2         CCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCCTATGAGGTGTTTGCT
NM_001099735.1      CCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCCTATGAGGTGTTTGCT
                    ************************************************************

HsCD00299536        GACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTGATGAAG
NM_001099736.1      GACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTGATGAAG
NM_001825.2         GACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTGATGAAG
NM_001099735.1      GACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTGATGAAG
                    ************************************************************

HsCD00299536        CACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTG
NM_001099736.1      CACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTG
NM_001825.2         CACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTG
NM_001099735.1      CACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTG
                    ************************************************************

HsCD00299536        CTGTCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGC
NM_001099736.1      CTGTCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGC
NM_001825.2         CTGTCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGC
NM_001099735.1      CTGTCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGC
                    ************************************************************

HsCD00299536        ACCCGGGCCGAGCGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAG
NM_001099736.1      ACCCGGGCCGAGCGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAG
NM_001825.2         ACCCGGGCCGAGCGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAG
NM_001099735.1      ACCCGGGCCGAGCGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAG
                    ************************************************************

HsCD00299536        GGGGACCTGGCTGGCCGCTACTACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGG
NM_001099736.1      GGGGACCTGGCTGGCCGCTACTACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGG
NM_001825.2         GGGGACCTGGCTGGCCGCTACTACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGG
NM_001099735.1      GGGGACCTGGCTGGCCGCTACTACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGG
                    ************************************************************

HsCD00299536        CTCATCGATGACCACTTTCTGTTTGATAAGCCAGTGTCCCCTTTATTAACATGTGCTGGG
NM_001099736.1      CTCATCGATGACCACTTTCTGTTTGATAAGCCAGTGTCCCCTTTATTAACATGTGCTGGG
NM_001825.2         CTCATCGATGACCACTTTCTGTTTGATAAGCCAGTGTCCCCTTTATTAACATGTGCTGGG
NM_001099735.1      CTCATCGATGACCACTTTCTGTTTGATAAGCCAGTGTCCCCTTTATTAACATGTGCTGGG
                    ************************************************************

HsCD00299536        ATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCATAATTATGATAAGACATTTCTC
NM_001099736.1      ATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCATAATTATGATAAGACATTTCTC
NM_001825.2         ATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCATAATTATGATAAGACATTTCTC
NM_001099735.1      ATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCATAATTATGATAAGACATTTCTC
                    ************************************************************

HsCD00299536        ATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAAGGAGGCAATATG
NM_001099736.1      ATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAAGGAGGCAATATG
NM_001825.2         ATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAAGGAGGCAATATG
NM_001099735.1      ATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAAGGAGGCAATATG
                    ************************************************************

HsCD00299536        AAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAAGAA
NM_001099736.1      AAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAAGAA
NM_001825.2         AAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAAGAA
NM_001099735.1      AAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAAGAA
                    ************************************************************

HsCD00299536        CGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAAC
NM_001099736.1      CGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAAC
NM_001825.2         CGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAAC
NM_001099735.1      CGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAAC
                    ************************************************************

HsCD00299536        CTTGGAACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCA
NM_001099736.1      CTTGGAACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCA
NM_001825.2         CTTGGAACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCA
NM_001099735.1      CTTGGAACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCA
                    ************************************************************

HsCD00299536        CGCTTTTCTAAGATCCTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGAC
NM_001099736.1      CGCTTTTCTAAGATCCTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGAC
NM_001825.2         CGCTTTTCTAAGATCCTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGAC
NM_001099735.1      CGCTTTTCTAAGATCCTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGAC
                    ************************************************************

HsCD00299536        ACTGCCGCGGTCGCAGATGTGTACGACATTTCCAACATAGATAGAATTGGTCGATCAGAG
NM_001099736.1      ACTGCCGCGGTCGCAGATGTGTACGACATTTCCAACATAGATAGAATTGGTCGATCAGAG
NM_001825.2         ACTGCCGCGGTCGCAGATGTGTACGACATTTCCAACATAGATAGAATTGGTCGATCAGAG
NM_001099735.1      ACTGCCGCGGTCGCAGATGTGTACGACATTTCCAACATAGATAGAATTGGTCGATCAGAG
                    ************************************************************

HsCD00299536        GTTGAGCTTGTTCAGATAGTCATCGATGGAGTCAATTACCTGGTGGATTGTGAAAAGAAG
NM_001099736.1      GTTGAGCTTGTTCAGATAGTCATCGATGGAGTCAATTACCTGGTGGATTGTGAAAAGAAG
NM_001825.2         GTTGAGCTTGTTCAGATAGTCATCGATGGAGTCAATTACCTGGTGGATTGTGAAAAGAAG
NM_001099735.1      GTTGAGCTTGTTCAGATAGTCATCGATGGAGTCAATTACCTGGTGGATTGTGAAAAGAAG
                    ************************************************************

HsCD00299536        TTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCTCAGTTTGGCAAAAAGTTG
NM_001099736.1      TTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCTCAGTTTGGCAAAAAGTAA
NM_001825.2         TTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCTCAGTTTGGCAAAAAGTAA
NM_001099735.1      TTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCTCAGTTTGGCAAAAAGTAA
                    **********************************************************:.

Pathways

Reactome : Creatine metabolism
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives

Protein

UniProt : P17540
HPRD : 00425

Clone

Cloning Information : 231873
HIP Master Clone ID : 124250
Original Clone ID : FLH231873.01L

Organism


TAX_ID : 9606
Species Specific ID: 1160

Genome

Chromosome : 5
Map Location : 5q13.3
Ensembl : ENSG00000131730

Reagents

Labome : CKMT2-antibody