DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CG (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CG
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Sequence             
Original Clone ID: HsCD00298891
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00299554

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3309nts         Open reading frame : 1 to 3309
Reference Sequence Alignment

ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
TCAGCCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 3362
Start on reference sequence 54
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CG
Symbol Nomenclature : PIK3CG
SYNONYM : PI3CG; PI3K; PI3Kgamma; PIK3; p110gamma; p120-PI3K
Designation : 1-phosphatidylinositol 3-kinase|PI3-kinase subunit gamma|phosphatidylinositol 3 kinase gamma, p110 gamma|phosphatidylinositol 3-kinase catalytic 110-kD gamma|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit gamma|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphoinositide-3-kinase gamma catalytic subunit|ptdIns-3-kinase subunit gamma|ptdIns-3-kinase subunit p110-gamma|serine/threonine protein kinase PIK3CG
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
GENEID : 5294
HGNC : 8978
MIM : 601232
Vega : OTTHUMG00000157641
Target GenBank: BC035683

 

Reference Sequence Alignment

  

HsCD00299554        ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282426.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_002649.3         ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
XM_005250443.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282427.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
                    ************************************************************

HsCD00299554        CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282426.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_002649.3         CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
XM_005250443.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282427.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
                    ************************************************************

HsCD00299554        GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282426.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_002649.3         GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
XM_005250443.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282427.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
                    ************************************************************

HsCD00299554        GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282426.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_002649.3         GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
XM_005250443.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282427.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
                    ************************************************************

HsCD00299554        ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282426.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_002649.3         ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
XM_005250443.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282427.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
                    ************************************************************

HsCD00299554        CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282426.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_002649.3         CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
XM_005250443.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282427.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
                    ************************************************************

HsCD00299554        TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282426.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_002649.3         TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
XM_005250443.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282427.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
                    ************************************************************

HsCD00299554        CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282426.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_002649.3         CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
XM_005250443.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282427.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
                    ************************************************************

HsCD00299554        GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282426.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_002649.3         GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
XM_005250443.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282427.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
                    ************************************************************

HsCD00299554        GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282426.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_002649.3         GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
XM_005250443.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282427.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
                    ************************************************************

HsCD00299554        TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282426.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_002649.3         TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
XM_005250443.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282427.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
                    ************************************************************

HsCD00299554        TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282426.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_002649.3         TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
XM_005250443.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282427.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
                    ************************************************************

HsCD00299554        CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282426.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_002649.3         CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
XM_005250443.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282427.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
                    ************************************************************

HsCD00299554        ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282426.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_002649.3         ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
XM_005250443.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282427.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
                    ************************************************************

HsCD00299554        CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282426.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_002649.3         CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
XM_005250443.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282427.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
                    ************************************************************

HsCD00299554        GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282426.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_002649.3         GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
XM_005250443.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282427.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
                    ************************************************************

HsCD00299554        GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282426.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_002649.3         GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
XM_005250443.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282427.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
                    ***********.******** ***************************************

HsCD00299554        ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282426.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_002649.3         ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
XM_005250443.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282427.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
                    ************************************************************

HsCD00299554        TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282426.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_002649.3         TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
XM_005250443.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282427.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
                    ************************************************************

HsCD00299554        GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282426.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_002649.3         GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
XM_005250443.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282427.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
                    ************************************************************

HsCD00299554        CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282426.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_002649.3         CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
XM_005250443.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282427.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
                    ************************************************************

HsCD00299554        AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282426.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_002649.3         AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
XM_005250443.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282427.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
                    ************************************************************

HsCD00299554        CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282426.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_002649.3         CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
XM_005250443.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282427.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
                    ************************************************************

HsCD00299554        CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282426.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_002649.3         CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
XM_005250443.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282427.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
                    ************************************************************

HsCD00299554        GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282426.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_002649.3         GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
XM_005250443.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282427.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
                    ************************************************************

HsCD00299554        AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282426.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_002649.3         AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
XM_005250443.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282427.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
                    ************************************************************

HsCD00299554        GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282426.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_002649.3         GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
XM_005250443.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282427.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
                    ************************************************************

HsCD00299554        GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282426.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_002649.3         GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
XM_005250443.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282427.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
                    ************************************************************

HsCD00299554        ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282426.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_002649.3         ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
XM_005250443.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282427.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
                    ************************************************************

HsCD00299554        GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282426.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_002649.3         GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
XM_005250443.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282427.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
                    ************************************************************

HsCD00299554        CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282426.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_002649.3         CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
XM_005250443.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282427.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
                    ************************************************************

HsCD00299554        GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282426.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_002649.3         GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
XM_005250443.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282427.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
                    ************************************************************

HsCD00299554        AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282426.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_002649.3         AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
XM_005250443.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282427.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
                    ************************************************************

HsCD00299554        CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
NM_001282426.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_002649.3         CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
XM_005250443.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_001282427.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
                    ******************************************** ***************

HsCD00299554        CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282426.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_002649.3         CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
XM_005250443.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282427.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
                    ************************************************************

HsCD00299554        AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282426.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_002649.3         AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
XM_005250443.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282427.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
                    ************************************************************

HsCD00299554        CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282426.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_002649.3         CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
XM_005250443.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282427.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
                    ************************************************************

HsCD00299554        ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282426.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_002649.3         ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
XM_005250443.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282427.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
                    ************************************************************

HsCD00299554        TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282426.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_002649.3         TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
XM_005250443.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282427.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
                    ************************************************************

HsCD00299554        GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282426.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_002649.3         GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
XM_005250443.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282427.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
                    ************************************************************

HsCD00299554        TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282426.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_002649.3         TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
XM_005250443.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282427.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
                    ************************************************************

HsCD00299554        ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282426.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_002649.3         ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
XM_005250443.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282427.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
                    ************************************************************

HsCD00299554        GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282426.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_002649.3         GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
XM_005250443.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282427.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
                    ************************************************************

HsCD00299554        GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282426.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_002649.3         GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
XM_005250443.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282427.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
                    ************************************************************

HsCD00299554        ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282426.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_002649.3         ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
XM_005250443.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282427.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
                    ************************************************************

HsCD00299554        GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282426.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_002649.3         GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
XM_005250443.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282427.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
                    ************************************************************

HsCD00299554        TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282426.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_002649.3         TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
XM_005250443.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282427.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
                    ************************************************************

HsCD00299554        GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282426.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_002649.3         GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
XM_005250443.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282427.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
                    ************************************************************

HsCD00299554        TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282426.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_002649.3         TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
XM_005250443.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282427.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
                    ************************************************************

HsCD00299554        GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282426.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_002649.3         GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
XM_005250443.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282427.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
                    ************************************************************

HsCD00299554        AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282426.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_002649.3         AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
XM_005250443.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282427.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
                    ************************************************************

HsCD00299554        CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282426.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_002649.3         CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
XM_005250443.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282427.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
                    ************************************************************

HsCD00299554        CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282426.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_002649.3         CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
XM_005250443.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282427.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
                    ************************************************************

HsCD00299554        GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282426.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_002649.3         GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
XM_005250443.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282427.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
                    ************************************************************

HsCD00299554        ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282426.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_002649.3         ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
XM_005250443.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282427.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
                    ************************************************************

HsCD00299554        TCAGCCTTG
NM_001282426.1      TCAGCCTAA
NM_002649.3         TCAGCCTAA
XM_005250443.1      TCAGCCTAA
NM_001282427.1      TCAGCCTAA
                    *******:.

Pathways

NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Class IB PI3K non-lipid kinase events
NCI : EPHA forward signaling
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Thromboxane A2 receptor signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Focal Adhesion
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 231896
HIP Master Clone ID : 134966
Original Clone ID : FLH231896.01L
Original Clone ID : FLH230226.01L
Original Clone ID : HsCD00298891

Organism


TAX_ID : 9606
Species Specific ID: 5294

Genome

Chromosome : 7
Map Location : 7q22.3
Ensembl : ENSG00000105851

Reagents

Labome : PIK3CG-antibody