DNASU Plasmid Repository • 480.965.5697 | Email

AQP3 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AQP3
Gene Name:  aquaporin 3 (Gill blood group)
Sequence             
Original Clone ID: FLH271447.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00300238

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 879nts         Open reading frame : 1 to 879
Reference Sequence Alignment

ATGGGTCGACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGG
CTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGT
GGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAAC
CTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCC
CACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAG
CTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTT
GGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCC
AATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGACACTTGGATATGATCAATGGC
TTCTTTGACCAGTTCATAGGCACAGCCTCCCTTATCGTGTGTGTGCTGGCCATTGTTGAC
CCCTACAACAACCCCGTCCCCCGAGGCCTGGAGGCCTTCACCGTGGGCCTGGTGGTCCTG
GTCATTGGCACCTCCATGGGCTTCAACTCCGGCTATGCCGTCAACCCTGCCCGGGACTTT
GGCCCCCGCCTTTTTACAGCCCTTGCGGGCTGGGGCTCTGCAGTCTTCACGACCGGCCAG
CATTGGTGGTGGGTGCCCATCGTGTCCCCACTCCTGGGCTCCATTGCGGGTGTCTTCGTG
TACCAGCTGATGATCGGCTGCCACCTGGAGCAGCCCCCACCCTCCAACGAGGAAGAGAAT
GTGAAGCTGGCCCATGTGAAGCACAAGGAGCAGATCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 916
Start on reference sequence 38
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AQP3
Symbol Nomenclature : AQP3
SYNONYM : AQP-3; GIL
Designation : aquaglyceroporin-3|aquaporin 3 (GIL blood group)|aquaporin-3
Full Nomenclature : aquaporin 3 (Gill blood group)
GENEID : 360
HGNC : 636
MIM : 600170
Vega : OTTHUMG00000019769
Target GenBank: BC013566

 

Reference Sequence Alignment

  

HsCD00300238      ATGGGTCGACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGG
NM_004925.4       ATGGGTCGACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGG
                  ************************************************************

HsCD00300238      CTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGT
NM_004925.4       CTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGT
                  ************************************************************

HsCD00300238      GGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAAC
NM_004925.4       GGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAAC
                  ************************************************************

HsCD00300238      CTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCC
NM_004925.4       CTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCC
                  ************************************************************

HsCD00300238      CACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAG
NM_004925.4       CACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAG
                  ************************************************************

HsCD00300238      CTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTT
NM_004925.4       CTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTT
                  ************************************************************

HsCD00300238      GGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCC
NM_004925.4       GGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCC
                  ************************************************************

HsCD00300238      AATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGACACTTGGATATGATCAATGGC
NM_004925.4       AATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGACACTTGGATATGATCAATGGC
                  ************************************************************

HsCD00300238      TTCTTTGACCAGTTCATAGGCACAGCCTCCCTTATCGTGTGTGTGCTGGCCATTGTTGAC
NM_004925.4       TTCTTTGACCAGTTCATAGGCACAGCCTCCCTTATCGTGTGTGTGCTGGCCATTGTTGAC
                  ************************************************************

HsCD00300238      CCCTACAACAACCCCGTCCCCCGAGGCCTGGAGGCCTTCACCGTGGGCCTGGTGGTCCTG
NM_004925.4       CCCTACAACAACCCCGTCCCCCGAGGCCTGGAGGCCTTCACCGTGGGCCTGGTGGTCCTG
                  ************************************************************

HsCD00300238      GTCATTGGCACCTCCATGGGCTTCAACTCCGGCTATGCCGTCAACCCTGCCCGGGACTTT
NM_004925.4       GTCATTGGCACCTCCATGGGCTTCAACTCCGGCTATGCCGTCAACCCTGCCCGGGACTTT
                  ************************************************************

HsCD00300238      GGCCCCCGCCTTTTTACAGCCCTTGCGGGCTGGGGCTCTGCAGTCTTCACGACCGGCCAG
NM_004925.4       GGCCCCCGCCTTTTTACAGCCCTTGCGGGCTGGGGCTCTGCAGTCTTCACGACCGGCCAG
                  ************************************************************

HsCD00300238      CATTGGTGGTGGGTGCCCATCGTGTCCCCACTCCTGGGCTCCATTGCGGGTGTCTTCGTG
NM_004925.4       CATTGGTGGTGGGTGCCCATCGTGTCCCCACTCCTGGGCTCCATTGCGGGTGTCTTCGTG
                  ************************************************************

HsCD00300238      TACCAGCTGATGATCGGCTGCCACCTGGAGCAGCCCCCACCCTCCAACGAGGAAGAGAAT
NM_004925.4       TACCAGCTGATGATCGGCTGCCACCTGGAGCAGCCCCCACCCTCCAACGAGGAAGAGAAT
                  ************************************************************

HsCD00300238      GTGAAGCTGGCCCATGTGAAGCACAAGGAGCAGATCTTG
NM_004925.4       GTGAAGCTGGCCCATGTGAAGCACAAGGAGCAGATCTGA
                  ************************************* .

Pathways

NCI : Stabilization and expansion of the E-cadherin adherens junction
Reactome : Aquaporin-mediated transport
Reactome : Passive transport by Aquaporins
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Transmembrane transport of small molecules

Protein

UniProt : Q92482
HPRD : 08970

Clone

Cloning Information : 271447
HIP Master Clone ID : 56909
Original Clone ID : FLH271447.01L

Organism


TAX_ID : 9606
Species Specific ID: 360

Genome

Chromosome : 9
Map Location : 9p13
Ensembl : ENSG00000165272

Reagents

Labome : AQP3-antibody