DNASU Plasmid Repository • 480.965.5697 | Email

TAX1BP1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TAX1BP1
Gene Name:  Tax1 (human T-cell leukemia virus type I) binding protein 1
Sequence             
Original Clone ID: FLH271353.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  CLOSED
Source: HIP
Description: None
Comments: This clone is identical to HsCD00617891
Mutation/
Discrepancy :
No / No
Publications: PMID: 24817723
Title: Expression, purification and crystallization of the SKICH domain of human TAX1BP1
Authors:
HsCD00300502

Price:  Login for Pricing
UNAVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2370nts         Open reading frame : 1 to 2370
Reference Sequence Alignment

ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAA
AATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCA
TATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCT
CGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACA
GTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTAT
CAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTT
CGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATG
TTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAA
AAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAA
CAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAA
GCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTT
AAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCA
GTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAG
AAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAG
GAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAG
GTCCAGACTTTAAAAAATATAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAA
GAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTG
CTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAG
GAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCT
GTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAA
GTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGAT
CAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTC
CGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAA
AAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAA
ACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCC
TCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACA
AAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAA
TGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCA
AAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTA
GCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGG
AAAATGGAAGGTCAGAATTCCCAGAGTCCTCAATGTTTCAAAACATGCTCAGAGCAAAAT
GGTTATGTTCTCACATTGTCAAATGCACAACCAGTTCTGCAATATGGTAATCCTTATGCA
TCTCAGGAAACAAGAGATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCA
CCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGA
AACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTG
CCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTT
GATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAAC
TATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGC
AGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCAT
TTTGATCAGAATGTTCTAAATTTTGACTAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2437
Start on reference sequence 68
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TAX1BP1
Symbol Nomenclature : TAX1BP1
SYNONYM : CALCOCO3; T6BP; TXBP151
Designation : TRAF6-binding protein|tax1-binding protein 1
Full Nomenclature : Tax1 (human T-cell leukemia virus type I) binding protein 1
GENEID : 8887
Locus Tag : PRO0105
SYNONYM : HsCD00617891
HGNC : 11575
MIM : 605326
Vega : OTTHUMG00000023377
Target GenBank: BC050358

 

Reference Sequence Alignment

  

HsCD00300502        ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAA
NM_006024.6         ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAA
NM_001206901.1      ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAA
NM_001079864.2      ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAA
                    ************************************************************

HsCD00300502        AATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCA
NM_006024.6         AATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCA
NM_001206901.1      AATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCA
NM_001079864.2      AATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCA
                    ************************************************************

HsCD00300502        TATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCT
NM_006024.6         TATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCT
NM_001206901.1      TATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCT
NM_001079864.2      TATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCT
                    ************************************************************

HsCD00300502        CGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACA
NM_006024.6         CGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACA
NM_001206901.1      CGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACA
NM_001079864.2      CGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACA
                    ************************************************************

HsCD00300502        GTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTAT
NM_006024.6         GTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTAT
NM_001206901.1      GTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTAT
NM_001079864.2      GTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTAT
                    ************************************************************

HsCD00300502        CAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTT
NM_006024.6         CAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTT
NM_001206901.1      CAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTT
NM_001079864.2      CAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTT
                    ************************************************************

HsCD00300502        CGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATG
NM_006024.6         CGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATG
NM_001206901.1      CGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATG
NM_001079864.2      CGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATG
                    ************************************************************

HsCD00300502        TTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAA
NM_006024.6         TTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAA
NM_001206901.1      TTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAA
NM_001079864.2      TTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAA
                    ************************************************************

HsCD00300502        AAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAA
NM_006024.6         AAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAA
NM_001206901.1      AAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAA
NM_001079864.2      AAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAA
                    ************************************************************

HsCD00300502        CAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAA
NM_006024.6         CAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAA
NM_001206901.1      CAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAA
NM_001079864.2      CAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAA
                    ************************************************************

HsCD00300502        GCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTT
NM_006024.6         GCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTT
NM_001206901.1      GCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTT
NM_001079864.2      GCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTT
                    ************************************************************

HsCD00300502        AAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCA
NM_006024.6         AAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCA
NM_001206901.1      AAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCA
NM_001079864.2      AAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCA
                    ************************************************************

HsCD00300502        GTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAG
NM_006024.6         GTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAG
NM_001206901.1      GTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAG
NM_001079864.2      GTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAG
                    ************************************************************

HsCD00300502        AAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAG
NM_006024.6         AAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAG
NM_001206901.1      AAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAG
NM_001079864.2      AAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAG
                    ************************************************************

HsCD00300502        GAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAG
NM_006024.6         GAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAG
NM_001206901.1      GAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAG
NM_001079864.2      GAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAG
                    ************************************************************

HsCD00300502        GTCCAGACTTTAAAAAATATAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAA
NM_006024.6         GTCCAGACTTTAAAAAATTTAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAA
NM_001206901.1      GTCCAGACTTTAAAAAATTTAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAA
NM_001079864.2      GTCCAGACTTTAAAAAATTTAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAA
                    ******************:*****************************************

HsCD00300502        GAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTG
NM_006024.6         GAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTG
NM_001206901.1      GAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTG
NM_001079864.2      GAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTG
                    ************************************************************

HsCD00300502        CTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAG
NM_006024.6         CTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAG
NM_001206901.1      CTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAG
NM_001079864.2      CTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAG
                    ************************************************************

HsCD00300502        GAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCT
NM_006024.6         GAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCT
NM_001206901.1      GAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCT
NM_001079864.2      GAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCT
                    ************************************************************

HsCD00300502        GTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAA
NM_006024.6         GTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAA
NM_001206901.1      GTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAA
NM_001079864.2      GTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAA
                    ************************************************************

HsCD00300502        GTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGAT
NM_006024.6         GTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGAT
NM_001206901.1      GTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGAT
NM_001079864.2      GTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGAT
                    ************************************************************

HsCD00300502        CAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTC
NM_006024.6         CAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTC
NM_001206901.1      CAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTC
NM_001079864.2      CAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTC
                    ************************************************************

HsCD00300502        CGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAA
NM_006024.6         CGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAA
NM_001206901.1      CGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAA
NM_001079864.2      CGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAA
                    ************************************************************

HsCD00300502        AAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAA
NM_006024.6         AAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAA
NM_001206901.1      AAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAA
NM_001079864.2      AAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAA
                    ************************************************************

HsCD00300502        ACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCC
NM_006024.6         ACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCC
NM_001206901.1      ACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCC
NM_001079864.2      ACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCC
                    ************************************************************

HsCD00300502        TCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACA
NM_006024.6         TCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACA
NM_001206901.1      TCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACA
NM_001079864.2      TCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACA
                    ************************************************************

HsCD00300502        AAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAA
NM_006024.6         AAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAA
NM_001206901.1      AAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAA
NM_001079864.2      AAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAA
                    ************************************************************

HsCD00300502        TGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCA
NM_006024.6         TGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCA
NM_001206901.1      TGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCA
NM_001079864.2      TGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCA
                    ************************************************************

HsCD00300502        AAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTA
NM_006024.6         AAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTA
NM_001206901.1      AAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTA
NM_001079864.2      AAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTA
                    ************************************************************

HsCD00300502        GCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGG
NM_006024.6         GCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGG
NM_001206901.1      GCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGG
NM_001079864.2      GCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGG
                    ************************************************************

HsCD00300502        AAAATGGAAGGTCAGAATTCCCAGAGTCCTCAATGTTTCAAAACATGCTCAGAGCAAAAT
NM_006024.6         AAAATGGAAGGTCAGAATTCCCAGAGTCCTCAATGTTTCAAAACATGCTCAGAGCAAAAT
NM_001206901.1      AAAATGGAAG--------------------------------------------------
NM_001079864.2      AAAATGGAAG--------------------------------------------------
                    **********                                                  

HsCD00300502        GGTTATGTTCTCACATTGTCAAATGCACAACCAGTTCTGCAATATGGTAATCCTTATGCA
NM_006024.6         GGTTATGTTCTCACATTGTCAAATGCACAACCAGTTCTGCAATATGGTAATCCTTATGCA
NM_001206901.1      ------------------------------------------------------------
NM_001079864.2      ------------------------------------------------------------
                                                                                

HsCD00300502        TCTCAGGAAACAAGAGATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCA
NM_006024.6         TCTCAGGAAACAAGAGATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCA
NM_001206901.1      ----------------ATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCA
NM_001079864.2      ----------------ATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCA
                                    ********************************************

HsCD00300502        CCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGA
NM_006024.6         CCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGA
NM_001206901.1      CCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGA
NM_001079864.2      CCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGA
                    ************************************************************

HsCD00300502        AACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTG
NM_006024.6         AACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTG
NM_001206901.1      AACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTG
NM_001079864.2      AACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTG
                    ************************************************************

HsCD00300502        CCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTT
NM_006024.6         CCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTT
NM_001206901.1      CCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTT
NM_001079864.2      CCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTT
                    ************************************************************

HsCD00300502        GATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAAC
NM_006024.6         GATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAAC
NM_001206901.1      GATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAAC
NM_001079864.2      GATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAAC
                    ************************************************************

HsCD00300502        TATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGC
NM_006024.6         TATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGC
NM_001206901.1      TATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGC
NM_001079864.2      TATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGC
                    ************************************************************

HsCD00300502        AGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCAT
NM_006024.6         AGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCAT
NM_001206901.1      AGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCAT
NM_001079864.2      AGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCAT
                    ************************************************************

HsCD00300502        TTTGATCAGAATGTTCTAAATTTTGACTAG
NM_006024.6         TTTGATCAGAATGTTCTAAATTTTGACTAG
NM_001206901.1      TTTGATCAGAATGTTCTAAATTTTGACTAG
NM_001079864.2      TTTGATCAGAATGTTCTAAATTTTGACTAG
                    ******************************

Pathways

Reactome : Immune System
Reactome : Innate Immune System
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways

Protein

UniProt : Q86VP1
UniProt : A4D196
HPRD : 05618

Clone

Cloning Information : 271353
HIP Master Clone ID : 134624
Original Clone ID : FLH271353.01X

Organism


TAX_ID : 9606
Species Specific ID: 8887

Genome

Chromosome : 7
Map Location : 7p15
Ensembl : ENSG00000106052

Reagents

Labome : TAX1BP1-antibody