DNASU Plasmid Repository • 480.965.5697 | Email

SNAP29 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SNAP29
Gene Name:  synaptosomal-associated protein, 29kDa
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH262263.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00301195

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 774nts         Open reading frame : 1 to 774
Reference Sequence Alignment

ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 807
Start on reference sequence 34
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SNAP29
Symbol Nomenclature : SNAP29
SYNONYM : CEDNIK; SNAP-29
Designation : soluble 29 kDa NSF attachment protein|synaptosomal-associated protein 29|vesicle-membrane fusion protein SNAP-29
Full Nomenclature : synaptosomal-associated protein, 29kDa
GENEID : 9342
HGNC : 11133
MIM : 604202
Vega : OTTHUMG00000150765
Target GenBank: CR456582

 

Reference Sequence Alignment

  

HsCD00301195      ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
NM_004782.3       ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
                  ************************************************************

HsCD00301195      CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
NM_004782.3       CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
                  ************************************************************

HsCD00301195      AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
NM_004782.3       AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
                  ************************************************************

HsCD00301195      AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
NM_004782.3       AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
                  ************************************************************

HsCD00301195      CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
NM_004782.3       CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
                  ************************************************************

HsCD00301195      GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
NM_004782.3       GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
                  ************************************************************

HsCD00301195      AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
NM_004782.3       AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
                  ************************************************************

HsCD00301195      CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
NM_004782.3       CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
                  ************************************************************

HsCD00301195      CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
NM_004782.3       CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
                  ************************************************************

HsCD00301195      GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
NM_004782.3       GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
                  ************************************************************

HsCD00301195      AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
NM_004782.3       AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
                  ************************************************************

HsCD00301195      CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
NM_004782.3       CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
                  ************************************************************

HsCD00301195      GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTC---
NM_004782.3       GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTCTGA
                  ******************************************************   

Pathways

Panther : 5HT1 type receptor mediated signaling pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : 5HT3 type receptor mediated signaling pathway
Panther : 5HT4 type receptor mediated signaling pathway
Panther : Adrenaline and noradrenaline biosynthesis
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Beta3 adrenergic receptor signaling pathway
Panther : Cortocotropin releasing factor receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Ionotropic glutamate receptor pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Panther : Opioid prodynorphin pathway
Panther : Opioid proenkephalin pathway
Panther : Opioid proopiomelanocortin pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase

Protein

SMART domain : t_SNARE : Helical region found in SNAREs
UniProt : O95721
HPRD : 11968

Clone

Cloning Information : 262263
HIP Master Clone ID : 194218
Original Clone ID : FLH262263.01L

Organism


TAX_ID : 9606
Species Specific ID: 9342

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000099940

Reagents

Labome : SNAP29-antibody