DNASU Plasmid Repository • 480.965.5697 | Email

TGFB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TGFB1
Gene Name:  transforming growth factor, beta 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014504.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003015

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1173nts         Open reading frame : 1 to 1173
Reference Sequence Alignment

ATGCCGCCCTCCGGGCTGCGGCTGCTGCTGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
AACATGATCGTGCGCTCCTGCAAGTGCAGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1619
Start on reference sequence 447
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TGFB1
Symbol Nomenclature : TGFB1
SYNONYM : CED; DPD1; LAP; TGFB; TGFbeta
Designation : TGF-beta-1|latency-associated peptide|prepro-transforming growth factor beta-1|transforming growth factor beta-1
Full Nomenclature : transforming growth factor, beta 1
GENEID : 7040
GI : 60655328
GenBank Accession : AY889437
HGNC : 11766
MIM : 190180
Target GenBank: BC001180

 

Reference Sequence Alignment

  

HsCD00003015      ATGCCGCCCTCCGGGCTGCGGCTGCTGCTGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
NM_000660.5       ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTG
                  **************************** *******************************

HsCD00003015      CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
NM_000660.5       CTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTG
                  ************************************************************

HsCD00003015      GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
NM_000660.5       GTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCC
                  ************************************************************

HsCD00003015      AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
NM_000660.5       AGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTG
                  ************************************************************

HsCD00003015      TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
NM_000660.5       TACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAG
                  ************************************************************

HsCD00003015      GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
NM_000660.5       GCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATC
                  ************************************************************

HsCD00003015      TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
NM_000660.5       TATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTC
                  ************************************************************

HsCD00003015      CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
NM_000660.5       CGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTC
                  ************************************************************

HsCD00003015      AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
NM_000660.5       AAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGA
                  ************************************************************

HsCD00003015      TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
NM_000660.5       TACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTC
                  ************************************************************

HsCD00003015      ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
NM_000660.5       ACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGC
                  ************************************************************

HsCD00003015      GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
NM_000660.5       GCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACT
                  ************************************************************

HsCD00003015      ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
NM_000660.5       ACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTC
                  ************************************************************

HsCD00003015      ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
NM_000660.5       ATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTG
                  ************************************************************

HsCD00003015      GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
NM_000660.5       GACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATT
                  ************************************************************

HsCD00003015      GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
NM_000660.5       GACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAAC
                  ************************************************************

HsCD00003015      TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
NM_000660.5       TTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTG
                  ************************************************************

HsCD00003015      GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
NM_000660.5       GCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
                  ************************************************************

HsCD00003015      CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
NM_000660.5       CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCC
                  ************************************************************

HsCD00003015      AACATGATCGTGCGCTCCTGCAAGTGCAGCTAG
NM_000660.5       AACATGATCGTGCGCTCCTGCAAGTGCAGCTGA
                  *******************************..

Pathways

NCI : ALK1 signaling events
NCI : AP-1 transcription factor network
NCI : Glypican 1 network
NCI : IL12 signaling mediated by STAT4
NCI : IL27-mediated signaling events
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Regulation of Telomerase
NCI : Syndecan-1-mediated signaling events
NCI : Syndecan-2-mediated signaling events
NCI : TGF-beta receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Host Interactions with Influenza Factors
Reactome : Influenza Infection
Reactome : Influenza Virus Induced Apoptosis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Molecules associated with elastic fibres
Reactome : Non-integrin membrane-ECM interactions
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Syndecan interactions
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : ACE Inhibitor Pathway
WikiPathway : Adipogenesis
WikiPathway : Cell cycle
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Endochondral Ossification
WikiPathway : Epithelium TarBase
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Proteins and DNA Sequences in Cardicac Structures
WikiPathway : Senescence and Autophagy
WikiPathway : Squamous cell TarBase
WikiPathway : TCR Signaling Pathway
WikiPathway : TFs Regulate miRNAs related to cardiac hypertrophy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway

Protein

SMART domain : TGFB : Transforming growth factor-beta (TGF-beta) family
UniProt : P01137
HPRD : 01821

Clone

Cloning Information : 14504
HIP Master Clone ID : 28703
Original Clone ID : FLH014504.01X

Organism


TAX_ID : 9606
Species Specific ID: 7040

Genome

Chromosome : 19
Map Location : 19q13.1

Reagents

Labome : TGF-beta1-antibody