DNASU Plasmid Repository • 480.965.5697 | Email

NALP13 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NLRP13
Gene Name:  NLR family, pyrin domain containing 13
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH470008.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00303097

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3129nts         Open reading frame : 1 to 3129
Reference Sequence Alignment

ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
AAACTCGGG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 3157
Start on reference sequence 26
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NLRP13
Symbol Nomenclature : NLRP13
SYNONYM : CLR19.7; NALP13; NOD14; PAN13
Designation : NACHT, LRR and PYD containing protein 13|NACHT, LRR and PYD domains-containing protein 13|NACHT, leucine rich repeat and PYD containing 13|nucleotide-binding oligomerization domain protein 14|nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13
Full Nomenclature : NLR family, pyrin domain containing 13
GENEID : 126204
HGNC : 22937
MIM : 609660
Vega : OTTHUMG00000167839
Target GenBank: NM_176810

 

Reference Sequence Alignment

  

HsCD00303097        ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
NM_176810.2         ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
XM_005258510.1      ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
                    ************************************************************

HsCD00303097        CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
NM_176810.2         CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
XM_005258510.1      CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
                    ************************************************************

HsCD00303097        CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
NM_176810.2         CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
XM_005258510.1      CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
                    ************************************************************

HsCD00303097        AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
NM_176810.2         AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
XM_005258510.1      AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
                    ************************************************************

HsCD00303097        GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
NM_176810.2         GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
XM_005258510.1      GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
                    ************************************************************

HsCD00303097        GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
NM_176810.2         GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
XM_005258510.1      GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
                    ************************************************************

HsCD00303097        GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
NM_176810.2         GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
XM_005258510.1      GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
                    ************************************************************

HsCD00303097        AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
NM_176810.2         AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
XM_005258510.1      AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
                    ************************************************************

HsCD00303097        CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
NM_176810.2         CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
XM_005258510.1      CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
                    ************************************************************

HsCD00303097        AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
NM_176810.2         AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
XM_005258510.1      AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
                    ************************************************************

HsCD00303097        CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
NM_176810.2         CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
XM_005258510.1      CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
                    ************************************************************

HsCD00303097        CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
NM_176810.2         CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
XM_005258510.1      CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
                    ************************************************************

HsCD00303097        AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
NM_176810.2         AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
XM_005258510.1      AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
                    ************************************************************

HsCD00303097        AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
NM_176810.2         AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
XM_005258510.1      AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
                    ************************************************************

HsCD00303097        TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
NM_176810.2         TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
XM_005258510.1      TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
                    ************************************************************

HsCD00303097        TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
NM_176810.2         TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
XM_005258510.1      TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
                    ************************************************************

HsCD00303097        TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
NM_176810.2         TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
XM_005258510.1      TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
                    ************************************************************

HsCD00303097        GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
NM_176810.2         GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
XM_005258510.1      GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
                    ************************************************************

HsCD00303097        ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
NM_176810.2         ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
XM_005258510.1      ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
                    ************************************************************

HsCD00303097        GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
NM_176810.2         GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
XM_005258510.1      GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
                    ************************************************************

HsCD00303097        GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
NM_176810.2         GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
XM_005258510.1      GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
                    ************************************************************

HsCD00303097        TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
NM_176810.2         TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
XM_005258510.1      TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
                    ************************************************************

HsCD00303097        AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
NM_176810.2         AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
XM_005258510.1      AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
                    ************************************************************

HsCD00303097        TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
NM_176810.2         TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
XM_005258510.1      TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
                    ************************************************************

HsCD00303097        AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
NM_176810.2         AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
XM_005258510.1      AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
                    ************************************************************

HsCD00303097        GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
NM_176810.2         GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
XM_005258510.1      GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
                    ************************************************************

HsCD00303097        ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
NM_176810.2         ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
XM_005258510.1      ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
                    ************************************************************

HsCD00303097        GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
NM_176810.2         GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
XM_005258510.1      GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
                    ************************************************************

HsCD00303097        ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
NM_176810.2         ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
XM_005258510.1      ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
                    ************************************************************

HsCD00303097        TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
NM_176810.2         TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
XM_005258510.1      TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
                    ************************************************************

HsCD00303097        GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
NM_176810.2         GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
XM_005258510.1      GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
                    ************************************************************

HsCD00303097        GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
NM_176810.2         GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
XM_005258510.1      GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
                    ************************************************************

HsCD00303097        TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
NM_176810.2         TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
XM_005258510.1      TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
                    ************************************************************

HsCD00303097        GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
NM_176810.2         GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
XM_005258510.1      GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
                    ************************************************************

HsCD00303097        TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
NM_176810.2         TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
XM_005258510.1      TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
                    ************************************************************

HsCD00303097        GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
NM_176810.2         GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
XM_005258510.1      GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
                    ************************************************************

HsCD00303097        ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
NM_176810.2         ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
XM_005258510.1      ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
                    ************************************************************

HsCD00303097        TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
NM_176810.2         TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
XM_005258510.1      TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
                    ************************************************************

HsCD00303097        ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
NM_176810.2         ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
XM_005258510.1      ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
                    ************************************************************

HsCD00303097        AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
NM_176810.2         AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
XM_005258510.1      AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
                    ************************************************************

HsCD00303097        ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
NM_176810.2         ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
XM_005258510.1      ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
                    ************************************************************

HsCD00303097        AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
NM_176810.2         AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
XM_005258510.1      AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
                    ************************************************************

HsCD00303097        ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
NM_176810.2         ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
XM_005258510.1      ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
                    ************************************************************

HsCD00303097        GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
NM_176810.2         GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
XM_005258510.1      GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
                    ************************************************************

HsCD00303097        GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
NM_176810.2         GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
XM_005258510.1      GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
                    ************************************************************

HsCD00303097        AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
NM_176810.2         AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
XM_005258510.1      AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
                    ************************************************************

HsCD00303097        CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
NM_176810.2         CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
XM_005258510.1      CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
                    ************************************************************

HsCD00303097        TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
NM_176810.2         TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
XM_005258510.1      TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
                    ************************************************************

HsCD00303097        GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
NM_176810.2         GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
XM_005258510.1      GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
                    ************************************************************

HsCD00303097        GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
NM_176810.2         GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
XM_005258510.1      GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
                    ************************************************************

HsCD00303097        TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
NM_176810.2         TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
XM_005258510.1      TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
                    ************************************************************

HsCD00303097        GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
NM_176810.2         GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
XM_005258510.1      GATACTGATGGTGTCAAGATGCTATGCTTCAAAAAGACCTGCACAATGTAG---------
                    ************************** :: ..:::**..:. :*.* .*.          

HsCD00303097        AAACTCGGG---
NM_176810.2         AAACTCGGGTAA
XM_005258510.1      ------------
                                

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : Q86W25
HPRD : 14804

Clone

Cloning Information : 470008
HIP Master Clone ID : 197069
Original Clone ID : FLH470008.01L

Organism


TAX_ID : 9606
Species Specific ID: 126204

Genome

Chromosome : 19
Map Location : 19q13.43
Ensembl : ENSG00000173572

Reagents

Labome : NLRP13-antibody