DNASU Plasmid Repository • 480.965.5697 | Email

RANGAP1 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RANGAP1
Gene Name:  Ran GTPase activating protein 1
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH262253.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00304172

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1761nts         Open reading frame : 1 to 1761
Reference Sequence Alignment

ATGGCCTCGGAAGACATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGG
GGACAGCTGAGTTTCAAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGAT
GTGATTAAAGAGATTGAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACA
GTGGGCGTGGAAGCAGCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAG
CGCTGCCACTGGAGTGACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTG
ATCTCACTAGGGGAAGGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGC
GACAACGCATTCGGGCCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCC
TGCTTCACCCTGCAGGAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAG
ATCCTGGCTGCAGCTCTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTG
GCCCTGAAGGTCTTTGTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTG
GCAGAAGCTTTTAGGGTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATC
AACCACCCTGGCATCACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTC
ATCAACCTGAATGACAACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTG
AAGACCTTGCGGCAGGTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGT
GCAGTTGCCATTGCAGATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTG
TCATTCTGTGAAATCAAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAA
GCTGAGCTGGAGAAGCTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAG
CTTCAGGAGGTGCTGGAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGAC
GAGGACGAGGAGGAGGAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAG
GAGGAAGATGAGGAAGAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAG
CGAGGGCAGGGAGAGAAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGG
GAGCCAGCTCCCGTGCTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTT
CCCTCTCCAGAGAAGCTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAG
ACTGACACGTCTGACCCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTC
AAGGACGAAGCTACTGTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAG
GCTTTCAACTCCTCGTCCTTCAACTCCAACACCTTCCTCACCAGGCTCCTCGTGCACATG
GGTCTGCTCAAGAGTGAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATG
GCGCTGAACCACATGGTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTG
GCGTTCGTGACCAAGCCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTG
CTGCAGACGCTGTACAAGGTC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1822
Start on reference sequence 62
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RANGAP1
Symbol Nomenclature : RANGAP1
SYNONYM : Fug1; RANGAP; SD
Designation : ran GTPase-activating protein 1|segregation distorter homolog|segregation distortion
Full Nomenclature : Ran GTPase activating protein 1
GENEID : 5905
Locus Tag : RP4-756G23.7
HGNC : 9854
MIM : 602362
Vega : OTTHUMG00000150940
Target GenBank: CR456557

 

Reference Sequence Alignment

  

HsCD00304172        ------------------------------------------------------------
NM_002883.3         ------------------------------------------------------------
XM_005261695.1      ATGGGGCTCCTGCGCCGCCCGCCTATCATTTGCGGCCTGTATTCGCGCGTCGCTCCCGCA
XM_005261696.1      ------------------------------------------ATGAATGATCTGGATCCC
NM_001278651.1      ------------------------------------------------------------
                                                                                

HsCD00304172        ------------------------------------------------------------
NM_002883.3         ------------------------------------------------------------
XM_005261695.1      GAGCCACCTCCCAGCAGGCCCACGCCCGCGGGGGCCCCGGGCTGGCGCCGCTGTCCCTGG
XM_005261696.1      ATAGCCATCTGTGTCCTGTTTGAGGAATGGGACCCTCAAACAGAGAACAGCCAAGATGCT
NM_001278651.1      ------------------------------------------------------------
                                                                                

HsCD00304172        ---------------------------------------------ATGGCCTCGGAAGAC
NM_002883.3         ---------------------------------------------ATGGCCTCGGAAGAC
XM_005261695.1      AATCGATTCTGCAGATCTCCAGGGGAGCCCACCAGCCTAGTCAACATGGCCTCGGAAGAC
XM_005261696.1      CAAGCAGTCTGCAGATCTCCAGGGGAGCCCACCAGCCTAGTCAACATGGCCTCGGAAGAC
NM_001278651.1      ---------------------------------------------ATGGCCTCGGAAGAC
                                                                 ***************

HsCD00304172        ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
NM_002883.3         ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
XM_005261695.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
XM_005261696.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
NM_001278651.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
                    ************************************************************

HsCD00304172        AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
NM_002883.3         AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
XM_005261695.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
XM_005261696.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
NM_001278651.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
                    ************************************************************

HsCD00304172        GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
NM_002883.3         GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
XM_005261695.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
XM_005261696.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
NM_001278651.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
                    ************************************************************

HsCD00304172        GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
NM_002883.3         GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
XM_005261695.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
XM_005261696.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
NM_001278651.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
                    ************************************************************

HsCD00304172        GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
NM_002883.3         GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
XM_005261695.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
XM_005261696.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
NM_001278651.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
                    ************************************************************

HsCD00304172        GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
NM_002883.3         GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
XM_005261695.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
XM_005261696.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
NM_001278651.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
                    ************************************************************

HsCD00304172        CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
NM_002883.3         CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
XM_005261695.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
XM_005261696.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
NM_001278651.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
                    ************************************************************

HsCD00304172        GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
NM_002883.3         GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
XM_005261695.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
XM_005261696.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
NM_001278651.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
                    ************************************************************

HsCD00304172        CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
NM_002883.3         CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
XM_005261695.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
XM_005261696.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
NM_001278651.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
                    ************************************************************

HsCD00304172        GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
NM_002883.3         GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
XM_005261695.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
XM_005261696.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
NM_001278651.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
                    ************************************************************

HsCD00304172        GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
NM_002883.3         GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
XM_005261695.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
XM_005261696.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
NM_001278651.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
                    ************************************************************

HsCD00304172        ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
NM_002883.3         ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
XM_005261695.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
XM_005261696.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
NM_001278651.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
                    ************************************************************

HsCD00304172        AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
NM_002883.3         AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
XM_005261695.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
XM_005261696.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
NM_001278651.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
                    ************************************************************

HsCD00304172        GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
NM_002883.3         GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
XM_005261695.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
XM_005261696.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
NM_001278651.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
                    ************************************************************

HsCD00304172        GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
NM_002883.3         GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
XM_005261695.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
XM_005261696.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
NM_001278651.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
                    ************************************************************

HsCD00304172        AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
NM_002883.3         AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
XM_005261695.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
XM_005261696.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
NM_001278651.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
                    ************************************************************

HsCD00304172        CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
NM_002883.3         CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
XM_005261695.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
XM_005261696.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
NM_001278651.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
                    ************************************************************

HsCD00304172        GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
NM_002883.3         GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
XM_005261695.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
XM_005261696.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
NM_001278651.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
                    ************************************************************

HsCD00304172        GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
NM_002883.3         GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
XM_005261695.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
XM_005261696.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
NM_001278651.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
                    ************************************************************

HsCD00304172        GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
NM_002883.3         GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
XM_005261695.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
XM_005261696.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
NM_001278651.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
                    ************************************************************

HsCD00304172        AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
NM_002883.3         AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
XM_005261695.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
XM_005261696.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
NM_001278651.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
                    ************************************************************

HsCD00304172        CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
NM_002883.3         CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
XM_005261695.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
XM_005261696.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
NM_001278651.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
                    ************************************************************

HsCD00304172        CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
NM_002883.3         CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
XM_005261695.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
XM_005261696.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
NM_001278651.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
                    ************************************************************

HsCD00304172        CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
NM_002883.3         CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
XM_005261695.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
XM_005261696.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
NM_001278651.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
                    ************************************************************

HsCD00304172        GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
NM_002883.3         GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
XM_005261695.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
XM_005261696.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
NM_001278651.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
                    ************************************************************

HsCD00304172        TCCTTCAACTCCAACACCTTCCTCACCAGGCTCCTCGTGCACATGGGTCTGCTCAAGAGT
NM_002883.3         TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
XM_005261695.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
XM_005261696.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
NM_001278651.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
                    ******************************** ***************************

HsCD00304172        GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
NM_002883.3         GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
XM_005261695.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
XM_005261696.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
NM_001278651.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
                    ************************************************************

HsCD00304172        GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
NM_002883.3         GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
XM_005261695.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
XM_005261696.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
NM_001278651.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
                    ************************************************************

HsCD00304172        CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
NM_002883.3         CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
XM_005261695.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
XM_005261696.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
NM_001278651.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
                    ************************************************************

HsCD00304172        AAGGTC---
NM_002883.3         AAGGTCTAG
XM_005261695.1      AAGGTCTAG
XM_005261696.1      AAGGTCTAG
NM_001278651.1      AAGGTCTAG
                    ******   

Pathways

NCI : Signaling events mediated by HDAC Class I
NCI : Signaling events mediated by HDAC Class II
NCI : Sumoylation by RanBP2 regulates transcriptional repression
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Disease
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Rev with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Rev-mediated nuclear export of HIV RNA
Reactome : Separation of Sister Chromatids

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : P46060
HPRD : 03839

Clone

Cloning Information : 262253
HIP Master Clone ID : 194457
Original Clone ID : FLH262253.01L

Organism


TAX_ID : 9606
Species Specific ID: 5905

Genome

Chromosome : 22
Map Location : 22q13
Ensembl : ENSG00000100401

Reagents

Labome : RANGAP1-antibody