DNASU Plasmid Repository • 480.965.2857 | Email

Detailed Vector Information: pSGP47


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pSGP47              
Source: Center for High-Throughput Structural Biology
Description: Yeast expression vector with Adh2 promoter, adds 3C protease cleavage site and 10xHis tag; ampicillin resistance (bacteria); uracil (yeast); ligation independent cloning (LIC).
Comments: None
Publications: PMID: 20045057
Title: Purification of transmembrane proteins from Saccharomyces cerevisiae for X-ray crystallography
Authors: PSI
Center for High Throughput Structural Biology
Mark Dumont
Nadia Fedoriw

Price:  Login for Pricing
No restriction
Special MTA: PSI



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  yeast    Marker:  URA
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGP47

pSGP47 in advanced viewed

Synonyms: None
Description: Yeast expression vector with Adh2 promoter, adds 3C protease cleavage site and 10xHis tag; ampicillin resistance (bacteria); uracil (yeast); ligation independent cloning (LIC).
Comments: S. cerevisiae expression strain
Size (bp): 6296
Parent Vector: None
Properties: ligation independent cloning (LIC), with tag/fusion/marker, yeast expression
Author Name: PSI
Center for High Throughput Structural Biology
Mark Dumont
Nadia Fedoriw
Publications: PMID: 20045057
Title: Purification of transmembrane proteins from Saccharomyces cerevisiae for X-ray crystallography

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
ligation independent cloning LIC Ligation independent cloning site 4220 4231
primer primer sequencing primer: CAATCAACTATCAACTATTAACTA 4155 4178
promoter Ura3 promoter Ura3 promoter 5981 6010
protease cleavage site 3C Rhinovirus 3C protease cleavage site 4233 4256
selectable marker AmpR ampicillan selectable marker 1742 2401
selectable marker Ura3 URA3 nutritional marker 5092 5895
tag His 10xHis tag 4275 4304


Species Specific ID: None
Target GenBank: None