DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pSGP36

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pSGP36              
Source: Center for High-Throughput Structural Biology
Description: Yeast expression vector with Gal1 promoter, adds C-terminal 3C-his10 tag; amp resistance (URA for yeast); ligation independent cloning (LIC).
Comments: None
Publications: None
Authors: Center for High Throughput Structural Biology
Mark Dumont
Kathleen Clark
PSI
EvNO00304418

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  yeast    Marker:  URA
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGP36

pSGP36 in advanced viewed

Synonyms: pSGP-36
Sequencing Primer: Forward:  pSGP36 forward
Reverse:  pSGP36 reverse
Description: Yeast expression vector with Gal1 promoter, adds C-terminal 3C-his10 tag; amp resistance (URA for yeast); ligation independent cloning (LIC).
Comments: None
Size (bp): 6185
Parent Vector: None
Properties: inducible expression, ligation independent cloning (LIC), with tag/fusion/marker, yeast expression, yeast shuttle
Author Name: Center for High Throughput Structural Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin 2499 3181
primer forward CAACATTTTCAGTTTGTATTACTTC 3983 4007
primer reverse CAAGGCGATTAAGTTGGGTAACGC 4279 4302
promoter Ura3 promoter Ura3 promoter 5870 5899
promoter T7 T7 promoter 4209 4229
protease cleavage site 3C 3C protease cleavage site 4122 4145
reporter gene LacZ LacZ alpha gene 4326 4394
selectable marker AmpR ampicillin resistance gene 1742 2401
selectable marker Ura3 URA3 nutritional marker 4981 5784
tag His 10xHis tag 4164 4193
trxn regulatory element lac operator lac operator 3521 3543

 

Species Specific ID: None
Target GenBank: None